ID: 1013349195

View in Genome Browser
Species Human (GRCh38)
Location 6:109290549-109290571
Sequence AGCGACGGCCGCCGCTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013349187_1013349195 -9 Left 1013349187 6:109290535-109290557 CCTGCCCCTGCCCCAGCGACGGC No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349183_1013349195 9 Left 1013349183 6:109290517-109290539 CCGGGGATGGCTGTGGCCCCTGC No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349182_1013349195 15 Left 1013349182 6:109290511-109290533 CCAACGCCGGGGATGGCTGTGGC No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349180_1013349195 18 Left 1013349180 6:109290508-109290530 CCTCCAACGCCGGGGATGGCTGT No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349179_1013349195 19 Left 1013349179 6:109290507-109290529 CCCTCCAACGCCGGGGATGGCTG No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349178_1013349195 20 Left 1013349178 6:109290506-109290528 CCCCTCCAACGCCGGGGATGGCT No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349177_1013349195 21 Left 1013349177 6:109290505-109290527 CCCCCTCCAACGCCGGGGATGGC No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349184_1013349195 -7 Left 1013349184 6:109290533-109290555 CCCCTGCCCCTGCCCCAGCGACG No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data
1013349185_1013349195 -8 Left 1013349185 6:109290534-109290556 CCCTGCCCCTGCCCCAGCGACGG No data
Right 1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013349195 Original CRISPR AGCGACGGCCGCCGCTCCGA GGG Intergenic
No off target data available for this crispr