ID: 1013350205

View in Genome Browser
Species Human (GRCh38)
Location 6:109298772-109298794
Sequence GTGGTGGGAAGGAGGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013350205_1013350213 23 Left 1013350205 6:109298772-109298794 CCACCTCTCCTCCTTCCCACCAC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013350205 Original CRISPR GTGGTGGGAAGGAGGAGAGG TGG (reversed) Intergenic
No off target data available for this crispr