ID: 1013350213

View in Genome Browser
Species Human (GRCh38)
Location 6:109298818-109298840
Sequence CTCTAATATGACTCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013350206_1013350213 20 Left 1013350206 6:109298775-109298797 CCTCTCCTCCTTCCCACCACCAC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350208_1013350213 12 Left 1013350208 6:109298783-109298805 CCTTCCCACCACCACAAAAGTTC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350209_1013350213 8 Left 1013350209 6:109298787-109298809 CCCACCACCACAAAAGTTCTTGC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350211_1013350213 4 Left 1013350211 6:109298791-109298813 CCACCACAAAAGTTCTTGCACAA No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350205_1013350213 23 Left 1013350205 6:109298772-109298794 CCACCTCTCCTCCTTCCCACCAC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350204_1013350213 28 Left 1013350204 6:109298767-109298789 CCTGACCACCTCTCCTCCTTCCC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350210_1013350213 7 Left 1013350210 6:109298788-109298810 CCACCACCACAAAAGTTCTTGCA No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350212_1013350213 1 Left 1013350212 6:109298794-109298816 CCACAAAAGTTCTTGCACAATTC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350203_1013350213 29 Left 1013350203 6:109298766-109298788 CCCTGACCACCTCTCCTCCTTCC No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data
1013350207_1013350213 15 Left 1013350207 6:109298780-109298802 CCTCCTTCCCACCACCACAAAAG No data
Right 1013350213 6:109298818-109298840 CTCTAATATGACTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013350213 Original CRISPR CTCTAATATGACTCTTTTTC TGG Intergenic
No off target data available for this crispr