ID: 1013352567

View in Genome Browser
Species Human (GRCh38)
Location 6:109318761-109318783
Sequence GCTGACAGGCACCCTATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013352567_1013352575 11 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352575 6:109318795-109318817 AGGGCCTTCAATGCAGTGGGGGG No data
1013352567_1013352583 28 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352583 6:109318812-109318834 GGGGGGCAGGCAGAGGGGAGGGG No data
1013352567_1013352582 27 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352582 6:109318811-109318833 TGGGGGGCAGGCAGAGGGGAGGG No data
1013352567_1013352578 21 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352578 6:109318805-109318827 ATGCAGTGGGGGGCAGGCAGAGG No data
1013352567_1013352579 22 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352579 6:109318806-109318828 TGCAGTGGGGGGCAGGCAGAGGG No data
1013352567_1013352570 -8 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352570 6:109318776-109318798 CTGTCAGCTGTGCTTGCAAAGGG No data
1013352567_1013352577 15 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG No data
1013352567_1013352581 26 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352581 6:109318810-109318832 GTGGGGGGCAGGCAGAGGGGAGG No data
1013352567_1013352574 10 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352574 6:109318794-109318816 AAGGGCCTTCAATGCAGTGGGGG No data
1013352567_1013352580 23 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352580 6:109318807-109318829 GCAGTGGGGGGCAGGCAGAGGGG No data
1013352567_1013352569 -9 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352569 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
1013352567_1013352571 7 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352571 6:109318791-109318813 GCAAAGGGCCTTCAATGCAGTGG No data
1013352567_1013352573 9 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352573 6:109318793-109318815 AAAGGGCCTTCAATGCAGTGGGG No data
1013352567_1013352572 8 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352572 6:109318792-109318814 CAAAGGGCCTTCAATGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013352567 Original CRISPR GCTGACAGGCACCCTATGCA AGG (reversed) Intergenic
No off target data available for this crispr