ID: 1013352568

View in Genome Browser
Species Human (GRCh38)
Location 6:109318775-109318797
Sequence CCTTTGCAAGCACAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013352568_1013352583 14 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352583 6:109318812-109318834 GGGGGGCAGGCAGAGGGGAGGGG No data
1013352568_1013352581 12 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352581 6:109318810-109318832 GTGGGGGGCAGGCAGAGGGGAGG No data
1013352568_1013352574 -4 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352574 6:109318794-109318816 AAGGGCCTTCAATGCAGTGGGGG No data
1013352568_1013352578 7 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352578 6:109318805-109318827 ATGCAGTGGGGGGCAGGCAGAGG No data
1013352568_1013352575 -3 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352575 6:109318795-109318817 AGGGCCTTCAATGCAGTGGGGGG No data
1013352568_1013352582 13 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352582 6:109318811-109318833 TGGGGGGCAGGCAGAGGGGAGGG No data
1013352568_1013352580 9 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352580 6:109318807-109318829 GCAGTGGGGGGCAGGCAGAGGGG No data
1013352568_1013352572 -6 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352572 6:109318792-109318814 CAAAGGGCCTTCAATGCAGTGGG No data
1013352568_1013352573 -5 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352573 6:109318793-109318815 AAAGGGCCTTCAATGCAGTGGGG No data
1013352568_1013352571 -7 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352571 6:109318791-109318813 GCAAAGGGCCTTCAATGCAGTGG No data
1013352568_1013352579 8 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352579 6:109318806-109318828 TGCAGTGGGGGGCAGGCAGAGGG No data
1013352568_1013352577 1 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013352568 Original CRISPR CCTTTGCAAGCACAGCTGAC AGG (reversed) Intergenic
No off target data available for this crispr