ID: 1013352577

View in Genome Browser
Species Human (GRCh38)
Location 6:109318799-109318821
Sequence CCTTCAATGCAGTGGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013352568_1013352577 1 Left 1013352568 6:109318775-109318797 CCTGTCAGCTGTGCTTGCAAAGG No data
Right 1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG No data
1013352567_1013352577 15 Left 1013352567 6:109318761-109318783 CCTTGCATAGGGTGCCTGTCAGC No data
Right 1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013352577 Original CRISPR CCTTCAATGCAGTGGGGGGC AGG Intergenic
No off target data available for this crispr