ID: 1013352643

View in Genome Browser
Species Human (GRCh38)
Location 6:109319308-109319330
Sequence AGGTTTTTCCAGAGGAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013352635_1013352643 8 Left 1013352635 6:109319277-109319299 CCCTTTGTAGTCAAGATTAGCTT No data
Right 1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG No data
1013352636_1013352643 7 Left 1013352636 6:109319278-109319300 CCTTTGTAGTCAAGATTAGCTTG No data
Right 1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG No data
1013352634_1013352643 27 Left 1013352634 6:109319258-109319280 CCTCTTCATGCAGAGATCACCCT No data
Right 1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013352643 Original CRISPR AGGTTTTTCCAGAGGAAGTT AGG Intergenic
No off target data available for this crispr