ID: 1013354938

View in Genome Browser
Species Human (GRCh38)
Location 6:109338202-109338224
Sequence CTTATTCACCAGTCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013354936_1013354938 3 Left 1013354936 6:109338176-109338198 CCTATGTAGTGGCTTTTCTGGGG No data
Right 1013354938 6:109338202-109338224 CTTATTCACCAGTCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013354938 Original CRISPR CTTATTCACCAGTCAGTGTC TGG Intergenic
No off target data available for this crispr