ID: 1013355733

View in Genome Browser
Species Human (GRCh38)
Location 6:109344374-109344396
Sequence CCCAGCAATCCCTGTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013355733_1013355743 6 Left 1013355733 6:109344374-109344396 CCCACACCACAGGGATTGCTGGG No data
Right 1013355743 6:109344403-109344425 ATGGTGGCTTGGCTGCCTCAGGG No data
1013355733_1013355739 -10 Left 1013355733 6:109344374-109344396 CCCACACCACAGGGATTGCTGGG No data
Right 1013355739 6:109344387-109344409 GATTGCTGGGCAGGCCATGGTGG No data
1013355733_1013355742 5 Left 1013355733 6:109344374-109344396 CCCACACCACAGGGATTGCTGGG No data
Right 1013355742 6:109344402-109344424 CATGGTGGCTTGGCTGCCTCAGG No data
1013355733_1013355740 -5 Left 1013355733 6:109344374-109344396 CCCACACCACAGGGATTGCTGGG No data
Right 1013355740 6:109344392-109344414 CTGGGCAGGCCATGGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013355733 Original CRISPR CCCAGCAATCCCTGTGGTGT GGG (reversed) Intergenic
No off target data available for this crispr