ID: 1013359224

View in Genome Browser
Species Human (GRCh38)
Location 6:109378462-109378484
Sequence GACAGTAAGTTGAAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013359218_1013359224 21 Left 1013359218 6:109378418-109378440 CCAAAAATACAGAACTCTGTCTC 0: 1
1: 0
2: 2
3: 20
4: 359
Right 1013359224 6:109378462-109378484 GACAGTAAGTTGAAGTGGTCAGG No data
1013359217_1013359224 27 Left 1013359217 6:109378412-109378434 CCTCTACCAAAAATACAGAACTC 0: 1
1: 0
2: 15
3: 677
4: 7039
Right 1013359224 6:109378462-109378484 GACAGTAAGTTGAAGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013359224 Original CRISPR GACAGTAAGTTGAAGTGGTC AGG Intronic
No off target data available for this crispr