ID: 1013361595

View in Genome Browser
Species Human (GRCh38)
Location 6:109398438-109398460
Sequence AATAATTATCCCTATGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013361592_1013361595 -6 Left 1013361592 6:109398421-109398443 CCAGGTGCTGGAGAGTCAATAAT 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1013361595 6:109398438-109398460 AATAATTATCCCTATGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013361595 Original CRISPR AATAATTATCCCTATGGAGT GGG Intronic
900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG + Intronic
901256166 1:7828814-7828836 AGTACTTCTCCCTATGCAGTAGG + Intronic
904313086 1:29641909-29641931 TATAATTATCCCAAGGGAGTGGG + Intergenic
906936966 1:50222797-50222819 AATAATTATTTCCATGGAGTTGG - Intergenic
907167713 1:52429371-52429393 AATAATTATCACTAAAAAGTTGG + Intronic
908561638 1:65311788-65311810 AATAATAATCCCTATGAAAAAGG - Intronic
913571896 1:120128966-120128988 ACTGATTATTCCTAGGGAGTAGG - Intergenic
914292815 1:146290589-146290611 ACTGATTATTCCTAGGGAGTAGG - Intergenic
914553859 1:148741372-148741394 ACTGATTATTCCTAGGGAGTAGG - Intergenic
915797989 1:158757236-158757258 AATAATTATCTCTGTGTACTTGG - Intergenic
915845764 1:159262961-159262983 AAAAATTCTTCCTGTGGAGTTGG + Intergenic
916442834 1:164844523-164844545 AATAATTTTCCCCAAGTAGTAGG + Intronic
918813863 1:189157434-189157456 AATAATTATCCATCTGAATTAGG - Intergenic
921256803 1:213348809-213348831 AACAATAAACCCTATGGAGCAGG + Intergenic
921389160 1:214602266-214602288 AATAATTATCTCTAAGGAGTGGG + Intergenic
921480100 1:215654870-215654892 AATAATTAGTCCTTTGGGGTAGG - Intronic
921697629 1:218230516-218230538 AATAAAAAACCCTATGAAGTTGG + Intergenic
923225168 1:231932460-231932482 AATAATAATCCCTATGTGTTAGG - Intronic
923963818 1:239113566-239113588 AATAATTGTCCTTATGGTGGTGG - Intergenic
1068622492 10:59202188-59202210 AAATATTATCCCAAAGGAGTGGG + Intronic
1068781365 10:60922224-60922246 AATCATTATCCATATGTAATGGG - Intronic
1070129925 10:73648761-73648783 CATAAGTACCCCTTTGGAGTGGG + Exonic
1070287665 10:75095438-75095460 AGCTATTTTCCCTATGGAGTGGG + Intronic
1071802173 10:89075954-89075976 AATAATTATTCCAATGCTGTTGG - Intergenic
1072908956 10:99483182-99483204 AATCAATTTCCCTTTGGAGTGGG + Intergenic
1076628554 10:131838572-131838594 AAGCATAATCCCTATGAAGTTGG + Intergenic
1078162274 11:8851841-8851863 ACTAATTATCTCTGTGTAGTAGG + Intronic
1079483110 11:20904394-20904416 AATAATTGTACCTATGTATTGGG - Intronic
1079819863 11:25112584-25112606 AATAATTATACTTAAGGTGTGGG - Intergenic
1087633006 11:100672583-100672605 AATAAGTAACCCTGAGGAGTTGG + Intergenic
1088362409 11:109004807-109004829 AATGGTTATGCCTATGGAGGTGG + Intergenic
1092024945 12:5232514-5232536 AAAAATTATGACTATAGAGTTGG + Intergenic
1092896689 12:13018868-13018890 AAAAAATATCCCTATAGAGCAGG - Intergenic
1099142595 12:78997457-78997479 AATAATTATGCCTTGAGAGTAGG + Intronic
1100572124 12:95852660-95852682 AACAATTATCCCTATGTCATGGG + Intergenic
1100778585 12:97999699-97999721 AATATTTATCTCTAGGTAGTAGG + Intergenic
1101817097 12:108153630-108153652 AAAAATTAGCTCTATGGAGAGGG + Intronic
1107030335 13:35844777-35844799 AATGATTATTGCTATGGACTTGG + Intronic
1108771146 13:53701375-53701397 AATCATTATGCCTCTGGAGTTGG + Intergenic
1109850277 13:68054557-68054579 AATAATTATCACTGTAGAGTAGG + Intergenic
1110796258 13:79641873-79641895 AATAATAATACCTATTGTGTGGG + Intergenic
1111834443 13:93370499-93370521 AATAAACATCCTTATTGAGTTGG - Intronic
1111968779 13:94888508-94888530 AATAGTTATCTCTAGGGAGGTGG - Intergenic
1112035678 13:95494436-95494458 AATAATTATCCCTTAGAATTGGG - Intronic
1113085236 13:106563272-106563294 CATAATTATTCCTATGCAGTGGG + Intronic
1116467569 14:45251520-45251542 AATAACTATTACTATGGAATGGG + Intronic
1118779261 14:68995703-68995725 AGTCATTATCCCTGAGGAGTGGG - Intergenic
1119795444 14:77392160-77392182 AAGAATTATCTCTCCGGAGTTGG - Intergenic
1120276491 14:82380661-82380683 AATAATAACCCCTATAGAATGGG - Intergenic
1121237041 14:92399295-92399317 AATCTTTATCCCTACGTAGTAGG - Intronic
1129972699 15:79793993-79794015 AAAAATGATTCCTATAGAGTTGG + Intergenic
1138895014 16:61193417-61193439 AATAATAATCCTTATGAACTAGG - Intergenic
1139086176 16:63588930-63588952 TATAATTTTCCTTATCGAGTAGG + Intergenic
1139510079 16:67422626-67422648 AATACCTCTCCCTAAGGAGTGGG - Intergenic
1149964551 17:61148672-61148694 AATAATTATACCTATCTTGTAGG - Intronic
1150660230 17:67068841-67068863 AATCAGTATCCCTGAGGAGTGGG + Intergenic
1150926759 17:69540405-69540427 AAGAATTATCCATTTGGGGTAGG + Intronic
1151915856 17:77117583-77117605 GAGAATTTTCCCCATGGAGTTGG + Intronic
1152972433 18:175790-175812 AAAAAATATCCCAGTGGAGTGGG - Intronic
1154260238 18:12825231-12825253 AAAATTTGTCCCTATTGAGTTGG - Intronic
1155310854 18:24521597-24521619 AATAATTATCTCAGTGCAGTGGG - Intergenic
1158201311 18:54944325-54944347 AATAAAAAGCCCTGTGGAGTAGG + Intronic
1158320093 18:56252807-56252829 AATAAAAATCCCAAAGGAGTGGG + Intergenic
1159891870 18:73960597-73960619 AATAATAATGCCTATGTAATGGG + Intergenic
926675600 2:15617438-15617460 AATGATTATCTCTAGGTAGTAGG - Intronic
928113164 2:28526450-28526472 AATAATTATCTCTAGATAGTGGG - Intronic
928142993 2:28746669-28746691 AACAATTGACCCTTTGGAGTTGG + Intergenic
932122404 2:69113704-69113726 AATAATTTTACCTTTGGAATTGG - Intronic
932220262 2:69993740-69993762 CATCATTATCCCTATGGAATGGG + Intergenic
933307657 2:80621868-80621890 AATAAATATCCCTGTGGCCTGGG + Intronic
934018956 2:87923595-87923617 AATTGTTATACCTATGAAGTGGG - Intergenic
936904564 2:117522352-117522374 AATAATTATCTGTATGCAGGTGG - Intergenic
938285051 2:130105852-130105874 AATAAATATCCCAATAGACTTGG - Intronic
938335694 2:130494401-130494423 AATAAATATCCCAATAGACTTGG - Intronic
938354127 2:130626263-130626285 AATAAATATCCCAATAGACTTGG + Intronic
938430554 2:131233040-131233062 AATAAATATCCCAATAGACTTGG + Intronic
940973473 2:159919123-159919145 ACTTATTTTCCCTGTGGAGTAGG + Intergenic
941174258 2:162177744-162177766 AATATCTACCCTTATGGAGTTGG - Intronic
942131411 2:172883971-172883993 AATAATTGGCCTCATGGAGTTGG + Intronic
945612443 2:212021216-212021238 AATTATTATACCTATTGAATAGG - Intronic
946683429 2:222241858-222241880 AATAATTAACTCTATGAAATAGG + Intronic
946787882 2:223266992-223267014 AATAGTTATCCCTATGTCCTGGG + Intergenic
1170091888 20:12598175-12598197 AATAATAATCCCATTAGAGTTGG - Intergenic
1171124548 20:22590293-22590315 TATAATTTTCCCTTTGGAATAGG - Intergenic
1171516621 20:25743446-25743468 GAGAATTATGCCTATGGATTTGG - Intergenic
1172434117 20:34916358-34916380 AATAATTATACCTATGTTATCGG + Intronic
1176068539 20:63213659-63213681 AATGATTTTCCCTGTGGAGGAGG - Intronic
1181856498 22:25785029-25785051 AATATTTGTACCCATGGAGTGGG + Intronic
1182487694 22:30649188-30649210 ACTGATGATCCCTATGGAGAGGG + Intronic
1182985003 22:34707947-34707969 AGTAATTATACCTAGGGAGAAGG - Intergenic
957251853 3:77781730-77781752 AAAAATTATCTCTAGGGATTTGG - Intergenic
959784153 3:110273439-110273461 CATAAAAATCTCTATGGAGTGGG + Intergenic
960404812 3:117246670-117246692 AATAATTATTCCTTTGGCATGGG - Intergenic
963536502 3:146535943-146535965 TTTAATTTTCCCTATGTAGTGGG + Intronic
965926050 3:173981410-173981432 AATAAATTTCCGTATGAAGTTGG + Intronic
971102724 4:23485638-23485660 AATAAATATCAGTATGAAGTAGG - Intergenic
972974430 4:44616298-44616320 AATAACTATGCATATGTAGTTGG - Intergenic
973045000 4:45525487-45525509 AATACTTTTCCCTATGAAGCAGG + Intergenic
979475620 4:121154164-121154186 TAAAATGATCACTATGGAGTTGG - Intronic
980609424 4:135138313-135138335 CATTATTATCCACATGGAGTTGG - Intergenic
980922964 4:139105564-139105586 AATCATTATCCCTAGAGTGTTGG - Intronic
981899443 4:149845335-149845357 AATATTTTCCCCTGTGGAGTTGG - Intergenic
984548844 4:181137094-181137116 AATAATTTTCCCTAAGTATTTGG - Intergenic
991588928 5:68228388-68228410 AATAAGTATCCCTTTGGGCTGGG - Intronic
991624105 5:68580427-68580449 AATAAATTTCCATATGGATTTGG - Intergenic
992857758 5:80880674-80880696 AATAATTATTCCTCAGGAGGAGG + Intergenic
994093754 5:95830538-95830560 AATAAATATCCCATTAGAGTAGG + Intergenic
994634562 5:102328071-102328093 AATTATTATTGTTATGGAGTGGG + Intergenic
994792563 5:104248711-104248733 AATAATTGACCCAATGGAGGCGG + Intergenic
997878391 5:137569150-137569172 AATAACCATCCCTACGCAGTAGG + Intronic
998503889 5:142656834-142656856 AATGATTACCCCTGGGGAGTGGG + Intronic
1000555160 5:162717282-162717304 AATAATTATCCTCATTGGGTAGG + Intergenic
1006975764 6:38099359-38099381 AATAATTATACATATATAGTGGG - Intronic
1013361595 6:109398438-109398460 AATAATTATCCCTATGGAGTGGG + Intronic
1020665682 7:11038972-11038994 AATCATTATCCCAAAGGATTAGG - Intronic
1022114016 7:27247290-27247312 AATAATGATCACCATGGAGCTGG + Intergenic
1022219903 7:28303267-28303289 AAAAATTATGCCTATGAATTGGG - Intronic
1022658461 7:32343462-32343484 TCTAATTCTCCCTGTGGAGTGGG - Intergenic
1023442608 7:40199971-40199993 AATGATTAACCCTGGGGAGTGGG + Intronic
1024441490 7:49424031-49424053 TATAATAATCCCTATGAACTAGG - Intergenic
1024854182 7:53757827-53757849 CATAATTATCCACATGGAGTGGG + Intergenic
1027795869 7:82693073-82693095 AATAATTCTCTCTATAGAGCTGG - Intergenic
1030900399 7:115116340-115116362 AATAATTATACCTATGTCATAGG - Intergenic
1030944722 7:115703783-115703805 AATTATTAGCCATATAGAGTGGG + Intergenic
1033102074 7:138482599-138482621 AATAATTATACTTAACGAGTCGG - Intronic
1034482443 7:151332929-151332951 AATAATTAAACCTAAGGAGGGGG + Intergenic
1038088193 8:24223083-24223105 AATACTTATCCCTAAGTAGCAGG - Intergenic
1038130115 8:24720569-24720591 AATAATTTTGCCTCAGGAGTGGG + Intergenic
1038976816 8:32706853-32706875 CATAATTACTCCTATGGAATAGG + Intronic
1045694547 8:104793673-104793695 AATAATTATGCCTATCTTGTTGG + Intronic
1046845034 8:118905994-118906016 AATCATTATCCCTGGGGGGTGGG + Intergenic
1047915960 8:129584157-129584179 AGTAGTTGTCCCTATGGACTGGG + Intergenic
1048347150 8:133584715-133584737 AATAATTATCATTATGGGGCTGG + Intergenic
1051574886 9:18604017-18604039 CATATTTATCCCTATGCATTTGG + Intronic
1052012905 9:23432117-23432139 AATATTTATTCCTAAGAAGTAGG - Intergenic
1052038788 9:23714361-23714383 AATAATTATCACCATGGATTTGG - Intronic
1052376863 9:27727497-27727519 TACAATTATCCCTGTGTAGTAGG + Intergenic
1058605512 9:106718121-106718143 AATAAATATCCCTCAGAAGTGGG - Intergenic
1059590346 9:115652719-115652741 AAAAATTTCACCTATGGAGTTGG - Intergenic
1059729555 9:117043469-117043491 AAAAATTAGCCCTGTGGAGCCGG - Intronic
1061309949 9:129755637-129755659 AATAATGATCCCTACCTAGTAGG + Intergenic
1061845746 9:133387122-133387144 CATAGTTATCCCTATGAAGGGGG + Intronic
1186327872 X:8499302-8499324 ATTACTTATCTCTATGAAGTGGG - Intergenic
1187279599 X:17847742-17847764 AATAAGTATCCATATGGATGGGG + Intronic
1188667133 X:32837934-32837956 AATAAATCTCCCTATGAAGTTGG - Intronic
1189150052 X:38697408-38697430 CATAATTATTCATAAGGAGTTGG + Intergenic
1190000447 X:46681475-46681497 AATAATTTTCCTTAAGGATTAGG + Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1192541022 X:71973262-71973284 CATACTCATCCCTATGGACTTGG - Intergenic
1194856446 X:98934971-98934993 AATAATTGTCCCAATGAAGCAGG - Intergenic
1198220897 X:134600840-134600862 TATAATTATCCCTACGTTGTGGG - Intronic
1199125571 X:144115545-144115567 AATTGTTATACCTATGAAGTGGG + Intergenic
1199379523 X:147152273-147152295 AATAAATATTCCTATGGAGATGG + Intergenic
1202169434 Y:22025695-22025717 AATAAGTTTCCCTGTGTAGTTGG - Intergenic
1202221931 Y:22560670-22560692 AATAAGTTTCCCTGTGTAGTTGG + Intergenic
1202321187 Y:23634997-23635019 AATAAGTTTCCCTGTGTAGTTGG - Intergenic
1202549580 Y:26035059-26035081 AATAAGTTTCCCTGTGTAGTTGG + Intergenic