ID: 1013362962

View in Genome Browser
Species Human (GRCh38)
Location 6:109411519-109411541
Sequence CTGGTTACACAGATATAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013362962 Original CRISPR CTGGTTACACAGATATAACC AGG Intronic
No off target data available for this crispr