ID: 1013365358

View in Genome Browser
Species Human (GRCh38)
Location 6:109433578-109433600
Sequence CCTTCTTTGGAGCAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013365353_1013365358 3 Left 1013365353 6:109433552-109433574 CCTTCAGCACTAAGAGTATGAGG 0: 1
1: 0
2: 2
3: 4
4: 108
Right 1013365358 6:109433578-109433600 CCTTCTTTGGAGCAGAGAGAGGG 0: 1
1: 0
2: 8
3: 40
4: 360
1013365352_1013365358 20 Left 1013365352 6:109433535-109433557 CCTGATGGTTTCTAGGGCCTTCA 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1013365358 6:109433578-109433600 CCTTCTTTGGAGCAGAGAGAGGG 0: 1
1: 0
2: 8
3: 40
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013365358 Original CRISPR CCTTCTTTGGAGCAGAGAGA GGG Intronic
900879421 1:5370018-5370040 TCTTCCTTGGAGCCTAGAGAAGG + Intergenic
900926799 1:5711102-5711124 ACTTCAGTGGAGGAGAGAGAAGG + Intergenic
901251913 1:7785049-7785071 CCTTCCCTGGAGCAGGGAAAGGG + Intronic
901266285 1:7913318-7913340 TCACCTTTGGAGCAGAAAGACGG - Intergenic
901306741 1:8238513-8238535 CCTCCTTTGGAGCAGACATGTGG - Intergenic
901422724 1:9162006-9162028 CCTTCTTTGGCCCACAGAGCAGG - Intergenic
902354036 1:15882983-15883005 CCTTCTTCCCAGAAGAGAGAGGG + Intronic
904850903 1:33458931-33458953 CCTTCTGATCAGCAGAGAGAAGG + Intergenic
906167146 1:43694883-43694905 CCTAATTTGGAGGTGAGAGAGGG + Exonic
906508237 1:46395568-46395590 CCTTCTTATGTGCTGAGAGAGGG + Intronic
907059736 1:51409346-51409368 CCTTCTTTAGAGGAAATAGAAGG - Intronic
907203566 1:52749366-52749388 GCTTATTTGGGGCAGGGAGAAGG + Intronic
907446625 1:54512278-54512300 CCGTCTTTAAAGCAGAGAGCTGG - Intergenic
907640658 1:56186276-56186298 CTTTCTCTGGAGTAGAGAGCAGG + Intergenic
907729118 1:57048820-57048842 CCTGCATTGTAGCAGAGAGACGG + Intronic
908499479 1:64728943-64728965 CCATCTTAGAAGCAGAGAGCAGG + Intergenic
908609013 1:65835283-65835305 CTCTCTTTGGAGAACAGAGAGGG - Intronic
909461344 1:75918413-75918435 CTTCCTTTGGAGCAGAGAGCAGG - Intergenic
909983944 1:82137307-82137329 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
911317707 1:96375467-96375489 CCATCTTTGAAGCAGAGACTAGG + Intergenic
914747800 1:150512333-150512355 CCCACTGTGGACCAGAGAGAGGG - Exonic
915514303 1:156403862-156403884 CCTTTTGTGGAGGAGACAGAAGG + Intergenic
915899199 1:159834316-159834338 CATTCTCTCCAGCAGAGAGAAGG + Intronic
915919934 1:159968565-159968587 CCTTCTTTGTAGGGGAGAGAGGG + Intergenic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
918640705 1:186837907-186837929 CCTCCTTTGTGGCAGGGAGAAGG + Intronic
919349699 1:196433120-196433142 CCATCTTGAAAGCAGAGAGAAGG + Intronic
919628103 1:199932253-199932275 CCTTCTTGGAAGCAGAGAGATGG + Intergenic
919703059 1:200651473-200651495 CCATCTTTGAAGTAGAGAGCAGG + Intronic
919901760 1:202048926-202048948 CCTGCTTTTAGGCAGAGAGAGGG + Intergenic
920031519 1:203040241-203040263 CCCTCGTATGAGCAGAGAGATGG + Intronic
920588727 1:207195788-207195810 CCTTCTTTGGAGTTGAAACAAGG - Intergenic
920715503 1:208336467-208336489 CTTTCTCTGAAGCAGAGAGGAGG - Intergenic
920927591 1:210357358-210357380 CCTTCTTTTGTGTATAGAGAAGG - Intronic
922819106 1:228471612-228471634 CCTCCTTTGGAGGACACAGATGG - Intergenic
923884150 1:238136703-238136725 CCTTGTGTGGAGCACAGAGTGGG - Intergenic
924906442 1:248458172-248458194 CCTTCTTTGAAGCAAACAGGAGG + Intergenic
924921445 1:248633854-248633876 CCTTCTTTGAAGCAAACAGGAGG - Intergenic
1063559291 10:7111559-7111581 CCTTCTTCAGAGATGAGAGAAGG - Intergenic
1063821953 10:9846325-9846347 CTCTCTCTGCAGCAGAGAGAGGG - Intergenic
1065180517 10:23120052-23120074 CCTTCTTTTGAGCAGGGATAAGG + Intronic
1065746242 10:28845197-28845219 CAGGCTTTGCAGCAGAGAGAGGG + Intergenic
1066055878 10:31679444-31679466 CTTTCTTTGGGGAAGAAAGATGG - Intergenic
1068633418 10:59321918-59321940 CCTTCTTTGGGGCAGTGGGCTGG - Intronic
1068834676 10:61541105-61541127 CTTTCTTTGTTGCAGACAGAAGG - Intergenic
1069834578 10:71300657-71300679 CCTTCTGTAAAGCAGAGTGATGG + Exonic
1070144101 10:73761152-73761174 CCTTCTGTGGAGCAGTGACTGGG + Intronic
1070628550 10:78068150-78068172 CCATCTCTGGAGCTGAGGGAGGG + Intergenic
1071160356 10:82738566-82738588 CCTTCTTTGCACCTGAGAAAAGG - Exonic
1072538254 10:96379334-96379356 CCTTGTTTTGAGCAGGGAGCAGG - Intronic
1073419623 10:103413971-103413993 CGTTCTTAGAATCAGAGAGATGG - Exonic
1073867233 10:107818974-107818996 CCATCTGTGGAGCAGACAGATGG + Intergenic
1074150048 10:110751030-110751052 CCTTTTTGCCAGCAGAGAGAGGG + Intronic
1075825756 10:125356079-125356101 CCCTGTCTGGAGCAGAGAGGTGG + Intergenic
1076119252 10:127922596-127922618 GGTTCTGTGGAGCAGAGAGCTGG - Intronic
1078715621 11:13836499-13836521 GCTACTTTGTAGCAGGGAGAAGG - Intergenic
1079459129 11:20664448-20664470 TATTCTTTAGAGCAGAGGGAAGG + Intergenic
1080593034 11:33740082-33740104 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
1081848263 11:46256790-46256812 CCATCTTGGAAGCAGAGAGCAGG + Intergenic
1082982262 11:59134598-59134620 CCATCTTTGGTTCAGAGGGATGG - Intergenic
1083143471 11:60740254-60740276 CTTTCTCTGGAGCAGAGGGTGGG - Intronic
1083445034 11:62702665-62702687 CCATCTTTGTAACAGAGAGAAGG - Intronic
1083692635 11:64419626-64419648 CCTTCTGGGGAGCACAGCGAGGG + Intergenic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1084900667 11:72307723-72307745 CCTTCTTTGTAACACAGAGAAGG + Intronic
1085735791 11:79037914-79037936 CCTATTGTGGAACAGAGAGAAGG + Intronic
1086518021 11:87636622-87636644 CTTCCTTTGGAGCATAGAGCAGG + Intergenic
1087211910 11:95453609-95453631 CCTATTTGGGAGCAGAGGGATGG - Intergenic
1087873305 11:103326220-103326242 CGTTCTTGGGAGTAGAGGGAGGG + Intronic
1088834860 11:113568900-113568922 ACTTCCTTGGGGCACAGAGATGG - Intergenic
1088947139 11:114525624-114525646 CCTTCTGTGCAGCACAGTGAAGG + Intronic
1089409143 11:118224248-118224270 CCTACTCTGGAGAAGAGAGCAGG - Intronic
1090998706 11:131890056-131890078 CTTCCTTTGGAGCAGAGAATTGG - Intronic
1091405965 12:209778-209800 CCGTTTTTGTAGCAGAGATAGGG + Exonic
1091413488 12:259856-259878 CCATTTTTGTAGCAGAGATAGGG + Exonic
1093814874 12:23533634-23533656 CCATCTTTAAAGTAGAGAGATGG + Exonic
1094256714 12:28438388-28438410 CCATCTTTGAAGCAGAGAACAGG + Intronic
1096023747 12:48343518-48343540 CCTGCTGTGTAGCACAGAGATGG - Exonic
1096042982 12:48536230-48536252 CCTACTTGAGAGCAGAGGGAGGG + Intergenic
1097020984 12:56020785-56020807 CCTCCTTTCCAGCAGTGAGAGGG - Intronic
1102448927 12:113026055-113026077 CCCTATTTGGAGCAGATAGATGG + Intergenic
1102605985 12:114067568-114067590 CCTTCTTTGGACCAGACATTAGG - Intergenic
1102918856 12:116776728-116776750 CCTGCTTTGGAGGAGACAGATGG + Intronic
1103412542 12:120722736-120722758 TCTTCTTTGGAGAAGCTAGAAGG - Exonic
1103949510 12:124543266-124543288 CCTTGTTGGGAGCAGACAGGTGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105840958 13:24253342-24253364 CCTTCTAGGGAAGAGAGAGAGGG - Intronic
1105968076 13:25402921-25402943 CCATCTTTGAAGCAGACACAGGG - Intronic
1107029927 13:35840105-35840127 CTGTCTGTGGAGCAGAGAGAAGG + Intronic
1109809639 13:67495271-67495293 CCTTGTTTGGGGCAGGGAGCAGG - Intergenic
1112280828 13:98061586-98061608 ACTTCCTTGGAACAGAAAGAAGG + Intergenic
1112788444 13:102977512-102977534 CCATTTTGGGAGCAGAGAGTTGG + Intergenic
1113603055 13:111584884-111584906 CATTCTTTCGAGCGCAGAGAAGG + Intergenic
1114009814 14:18354915-18354937 CCTTCTTTGGATCAGACATTAGG - Intergenic
1114253607 14:20982688-20982710 GCTTTTTGGGAGCACAGAGATGG - Intergenic
1114488475 14:23079839-23079861 CCATCTTTGGAACAGAAGGAAGG - Exonic
1114584938 14:23802682-23802704 CCATCTTTGAAGCAGAGACCAGG - Intergenic
1114802801 14:25797497-25797519 CCTTATTGGGAGCAGACAGTGGG + Intergenic
1118095704 14:62535165-62535187 CCTTTTTTGGGGCAAAAAGAAGG - Intergenic
1118142558 14:63100421-63100443 GCTCCTTTGAAGCAGAGAGAGGG + Intronic
1118319967 14:64747298-64747320 CCTCCTCTGGGGCAGAGAGCAGG - Exonic
1118781175 14:69008934-69008956 CCTCACTTGGAGGAGAGAGATGG + Intergenic
1118861558 14:69668206-69668228 TCTTCTGTGGAGAAAAGAGAGGG + Intronic
1119547636 14:75484016-75484038 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119547644 14:75484064-75484086 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1120778555 14:88464281-88464303 CTTTCTTTTGAGCTGAGGGATGG - Intronic
1121437849 14:93930703-93930725 CCTTCTTTGGAGTCCAGACATGG + Intergenic
1121851951 14:97229410-97229432 CCATTTTTGAAGCAGAGAGTGGG - Intergenic
1122043633 14:99008179-99008201 CAATCTGTGGAGAAGAGAGAGGG - Intergenic
1122918503 14:104869758-104869780 CCATCCTTGAAGCAGAGACAGGG + Intronic
1124159540 15:27255939-27255961 ACATCTTTGGTGGAGAGAGAGGG - Intronic
1125968834 15:43895525-43895547 GCTGCTTTAGAGCAGAGAGCTGG + Intronic
1126210434 15:46095125-46095147 CCTTCCTTGAAGCAGGGAGAAGG - Intergenic
1127816504 15:62614544-62614566 TGTTCTTTCGAGCAGAGAGGTGG - Intronic
1128058910 15:64721183-64721205 CGTTCTTTGTAGGAGAAAGAGGG - Intergenic
1128357669 15:66939615-66939637 CCTTTTTTGGGGCAGAGGGGTGG - Intergenic
1128714956 15:69901217-69901239 GCTGCTGTGGAGCAGAGAGGAGG + Intergenic
1128818567 15:70631636-70631658 CCTTCTTGGGAGCACAGGCAGGG - Intergenic
1129243201 15:74264042-74264064 CCATCTGTGCAGCAGAGAGAGGG + Intronic
1129380272 15:75160667-75160689 CCATCTTGGAAGCAGAGAGCAGG - Intergenic
1130230533 15:82093452-82093474 CCTTCTGTGAATCAGAGAGTGGG - Intergenic
1131771791 15:95745900-95745922 GGATTTTTGGAGCAGAGAGATGG + Intergenic
1132248878 15:100318504-100318526 CCATCTGTGAAGCAGAGAGCAGG + Intronic
1133304638 16:4801582-4801604 CCTCCTGTGGAACAGAGGGAAGG + Exonic
1135951703 16:26920282-26920304 GCTTCTTTGGAGCAGACATTGGG - Intergenic
1136313185 16:29429518-29429540 CTTTCCTTGGGGCAGAGAAAAGG + Intergenic
1139122319 16:64035410-64035432 CCATCTATGAACCAGAGAGAAGG - Intergenic
1140106708 16:71967283-71967305 CCCTCTATGGATCAGAGGGACGG - Exonic
1140208057 16:72949566-72949588 CCGTCTATGGAGTAGAGGGAAGG + Intronic
1140357112 16:74315971-74315993 CCTTCTCTGGAGCAAAGGGGTGG - Intergenic
1141319464 16:82993874-82993896 CGTTCTTTGGTGCACAGAGAGGG + Intronic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142083044 16:88160225-88160247 CTCCCTTTGGAGCAAAGAGACGG + Intergenic
1142286118 16:89172201-89172223 TCTTGAGTGGAGCAGAGAGAGGG + Intronic
1142380746 16:89730592-89730614 CGTGCTTTGGAACAGAGACACGG + Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1144440995 17:15281512-15281534 CCTGCTTTGGTGCAGAGGGTGGG - Intergenic
1144939978 17:18932199-18932221 CTCTCTGTGGAGCACAGAGAAGG - Intergenic
1145762692 17:27435176-27435198 AGTTCATTGGAGCAGGGAGATGG + Intergenic
1148792998 17:50184052-50184074 CCTTCTTTGGAGTTGGGGGAGGG - Exonic
1149062088 17:52434479-52434501 CCATCTTTAAAGCAGAGAGCAGG + Intergenic
1149530284 17:57389567-57389589 GCATCTTTGGAGCAGAGATGAGG + Intronic
1149562219 17:57616368-57616390 CCTTCTTTTGAGGAAGGAGATGG - Intronic
1150688075 17:67336672-67336694 CCTTCTGTGATGCAGAGAAATGG - Intergenic
1151056163 17:71033628-71033650 TCTGCTTTAGAGCAGAGAAATGG + Intergenic
1151176568 17:72293506-72293528 CCTCCCTTGGAGAAAAGAGAGGG - Intergenic
1152087571 17:78230077-78230099 CCTTCTCTTGAGCTGAGAGCTGG - Intergenic
1153273013 18:3341889-3341911 CCATCTATGAAGCAGAGAGCAGG - Intergenic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1155858358 18:30864236-30864258 CCTTCTTGGGAGTTGAGACAAGG - Intergenic
1155959229 18:31979692-31979714 CCTGCTTTAGGGCAGAGAGTGGG - Intergenic
1156198167 18:34799429-34799451 CTTTTTTTGGTGCAGAGAAATGG - Intronic
1156422871 18:36974780-36974802 CCTTCTGTGATGCAGAGAAAGGG - Intronic
1157278965 18:46333691-46333713 CGTTCCTTAGTGCAGAGAGACGG - Intronic
1157393512 18:47322984-47323006 GTGTCTTTGCAGCAGAGAGAAGG + Intergenic
1157689928 18:49673221-49673243 CCTTCTCTGGGGCAGACATAAGG + Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158741381 18:60146293-60146315 TCTTCTTTGGAGCACAGAGCAGG + Intergenic
1158780663 18:60646556-60646578 TATATTTTGGAGCAGAGAGAGGG + Intergenic
1161461396 19:4400032-4400054 CCGCCTTTGCAGCGGAGAGAAGG + Intronic
1162088345 19:8261911-8261933 CCATCTGGGGAACAGAGAGAGGG - Exonic
1162268248 19:9593834-9593856 CCTTCTTTGGACCAGACATTAGG + Intergenic
1162496507 19:11026090-11026112 CCTTCGTTGGAGGAGTGTGAGGG + Intronic
1164490695 19:28711327-28711349 CCTTCTTTGAATCAGCTAGAGGG + Intergenic
1164551374 19:29215364-29215386 CCAGCGTTGCAGCAGAGAGATGG + Intergenic
1166279317 19:41780437-41780459 CCACCTTTGGAGCAGAAAGCAGG + Intergenic
1168249009 19:55130455-55130477 CCATCTGTGAAGCAGAGAGCAGG - Intergenic
926687392 2:15708825-15708847 CCGTCTTGGGAGCAGAGGCAGGG - Intronic
930186476 2:48417151-48417173 CCATCTTTGGTGGAGACAGATGG + Intergenic
930475404 2:51875552-51875574 CCTTCTTGTAAGCAGAAAGAAGG - Intergenic
931014200 2:57956700-57956722 CCTTATTTGGAGAAGAAAGTAGG + Intronic
932358096 2:71083294-71083316 CCTTCTTTGGGGGAGGGACAGGG - Intergenic
932370435 2:71182861-71182883 CCTTCTTTGGGGGAGGGACAGGG - Exonic
932624910 2:73289880-73289902 GGGTCATTGGAGCAGAGAGATGG + Intergenic
933983371 2:87571667-87571689 CCATCTCTTTAGCAGAGAGAAGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935234317 2:101125514-101125536 CTTTCTTTGGAACAGAAATAAGG - Intronic
935453785 2:103242058-103242080 CCTTCTTTTTCACAGAGAGATGG - Intergenic
935719382 2:105966789-105966811 CCTGCTCTTGGGCAGAGAGAAGG + Intergenic
935756296 2:106278590-106278612 TGTTCTCTGGAGCAGAGAGGTGG - Intergenic
935830902 2:106999874-106999896 CAGACTTTGGAGAAGAGAGACGG + Intergenic
936052879 2:109238856-109238878 CCTCCCTTGGGACAGAGAGAAGG - Intronic
936310477 2:111379127-111379149 CCATCTCTTTAGCAGAGAGAAGG + Intergenic
938422980 2:131158599-131158621 ACTTTTTTGGAGCAGGGGGAAGG - Intronic
938527129 2:132144413-132144435 CCTTCTTTGGATCAGACATTAGG + Intergenic
938802735 2:134777862-134777884 CCTTCTTTGCTTCAGAGAGAAGG + Intergenic
940141124 2:150491582-150491604 TCATCAATGGAGCAGAGAGATGG + Intronic
940500729 2:154490192-154490214 CTTTCTTTGTAGCAGAAAGGAGG - Intergenic
940551865 2:155169260-155169282 CCTTCTGTGGAGCAAGGAGAAGG - Intergenic
941901775 2:170685925-170685947 TCCTCTTAGGAGCAGAGAGCAGG - Intergenic
942285947 2:174416183-174416205 TCTTCTTTGGGGCAGATAGTGGG - Intronic
942664413 2:178301907-178301929 GCCTCTTGGAAGCAGAGAGACGG + Intronic
944932714 2:204536214-204536236 CTTGCTTTGGAGGAGAAAGAGGG + Intergenic
945155271 2:206831483-206831505 TCTTATCTGGAGCACAGAGATGG - Intergenic
946952229 2:224889545-224889567 CCTCCTTTGGAAGAGAGAAATGG - Intronic
947360049 2:229337493-229337515 CTTTCTCTGTAGCTGAGAGAGGG + Intergenic
948220826 2:236268374-236268396 AATTCTTTTTAGCAGAGAGAGGG + Intergenic
948230309 2:236344506-236344528 CCTCCTTTGGAGGAAAGAAAAGG + Intronic
948515202 2:238499143-238499165 GCTCCTGTGGGGCAGAGAGACGG + Intergenic
948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG + Intergenic
948654860 2:239470278-239470300 CCATCTTGGGAGCAGAGACCGGG + Intergenic
948668172 2:239549265-239549287 CCTTCTTGTGGGCAGAGTGATGG - Intergenic
1169804538 20:9545795-9545817 CAGCTTTTGGAGCAGAGAGAGGG - Intronic
1170367643 20:15615468-15615490 CCTTCATCAGAGCTGAGAGAGGG + Intronic
1170916111 20:20627656-20627678 CTTTCTGTGCAGCAGAGGGAGGG + Intronic
1171252969 20:23663358-23663380 TGTTCCTTGGAGCAGAGAAACGG - Intergenic
1171259455 20:23718675-23718697 TGTTCCTTGGAGCAGAGAAACGG - Intergenic
1173608935 20:44352427-44352449 CCCTCTTGGGAGCCAAGAGAGGG - Intergenic
1173639654 20:44591952-44591974 CCTTCTTGGCTGCAGGGAGAGGG - Intronic
1173641626 20:44606896-44606918 CCCTCTTGGAAGCAGAGAGCAGG + Intronic
1174376769 20:50131239-50131261 CCTTATATGGGGCAGAGAGAAGG - Intronic
1175613956 20:60376692-60376714 TCTCTTTTGGACCAGAGAGAAGG + Intergenic
1176988847 21:15469847-15469869 CCTTCTATGTAGCACTGAGAAGG - Intergenic
1177180546 21:17740182-17740204 CTTGCTTTGAAGCAGAAAGAGGG + Intergenic
1177208948 21:18045878-18045900 CCATCTGAGAAGCAGAGAGAAGG + Intronic
1177295326 21:19166275-19166297 CATTGTTTAGAGCAGGGAGAGGG + Intergenic
1178306422 21:31494510-31494532 CCTGCATAGGAGCAGAGAGGTGG - Intronic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1178922069 21:36745252-36745274 CCTACTTAGAAGCAGAAAGAGGG - Intronic
1179174809 21:39000675-39000697 CCTGCTTTGCAGCAGAGCCAGGG - Intergenic
1179584591 21:42366498-42366520 TCGCCTTTGGAGCAGAGAGGAGG - Exonic
1180434314 22:15285724-15285746 CCTTCTTTGGATCAGACATTAGG - Intergenic
1180516500 22:16149534-16149556 CCTTCTTTGGATCAGACATTAGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181372781 22:22431563-22431585 CCTGCCTTGGACCTGAGAGAGGG + Intergenic
1181543535 22:23587528-23587550 CCTTCCCTGGGGCACAGAGAAGG + Intergenic
1181789625 22:25254568-25254590 TCTTCTTTGTATCACAGAGAGGG + Intergenic
1182359276 22:29737370-29737392 CTTTCACTGGAGCACAGAGAAGG + Intronic
1182393266 22:30017227-30017249 CCTTCTGTTAAGCAGAGAAAAGG + Intronic
1183781580 22:40002359-40002381 CCCTCTTTGGGGAAGAGGGAGGG + Intronic
1183874387 22:40766639-40766661 CCTTCATAGGAGCAGTGGGAGGG - Intergenic
1184011759 22:41754003-41754025 TCTTCTCTGGAGCTGAGAGAAGG - Exonic
1184390957 22:44202963-44202985 CCTTCCACGGAGCTGAGAGAAGG - Intronic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949372874 3:3354383-3354405 CCTTCTTTGGAGGGCACAGATGG + Intergenic
950931368 3:16792210-16792232 CTTGCTTTGGAGGAGAAAGAGGG - Intergenic
953145365 3:40270044-40270066 CCATCTTGGAAGCAGAGAGTGGG - Intergenic
954815548 3:53277598-53277620 CCTTATTTTTAGCAGAGACAAGG - Intergenic
955687801 3:61563002-61563024 CCTCCTTGGGCGCAGTGAGACGG + Intronic
956554143 3:70498965-70498987 CTCTCATTGGAGGAGAGAGATGG + Intergenic
956609361 3:71106714-71106736 CCTTCTTAGTAGCTGAGATATGG + Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
959849794 3:111072256-111072278 CGTTCTCTGGAGCAGCGAGGCGG + Intronic
960292862 3:115907420-115907442 CCATCTATGAAGCAGAGAGTGGG + Intronic
960767757 3:121155633-121155655 CCTTTTTTTGAGAAAAGAGAGGG + Intronic
960849643 3:122038266-122038288 CATTCTGTGGAGCAGTGTGAAGG + Intergenic
961582464 3:127893805-127893827 CCTTCTTTGGACCAGACACTAGG - Intergenic
961611278 3:128142025-128142047 ACTGCTTTGGAGCCTAGAGACGG + Intronic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
961908264 3:130285415-130285437 CCTTGTTGGGAGCAAGGAGAGGG - Intergenic
962047373 3:131775147-131775169 CCTTCTTTGGAGGTGAAAAAAGG - Intronic
962432470 3:135332549-135332571 CCTACTATGGTGCAGAGAGGTGG - Intergenic
964087874 3:152838807-152838829 CCTTATTTTGAGGAAAGAGAGGG + Intergenic
967138176 3:186529972-186529994 CCATCACTGGAGCAGAGAGAGGG + Intergenic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969050516 4:4369681-4369703 CCTCCTGTGGTGGAGAGAGAGGG + Intronic
969329139 4:6462989-6463011 CCTTCTCTGGGACAGAGGGAGGG + Intronic
969662836 4:8540404-8540426 CTTGTTTGGGAGCAGAGAGATGG - Intergenic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
970574961 4:17418190-17418212 CCTACCCTGGAGCAGAGAGGAGG - Intergenic
971166172 4:24186143-24186165 CCTTGTGTGGGGCACAGAGAGGG + Intergenic
972273686 4:37536963-37536985 CCAGCTTTGGGGCAGAGTGACGG + Intronic
972732998 4:41813662-41813684 CCATCTTGGAAGTAGAGAGATGG - Intergenic
973652202 4:53007270-53007292 CCTTGTTGAGAGGAGAGAGAGGG + Intronic
973731041 4:53822548-53822570 ACCTTTTTGGAGCAGAGGGAGGG - Intronic
974096313 4:57368424-57368446 CCATCTATGAAGCAGAGAGTAGG - Intergenic
976866256 4:89731013-89731035 CCTTCTTTACAACAGGGAGAAGG + Intronic
976950306 4:90820412-90820434 CCATCTTGGAAGCAGAGAGATGG - Intronic
978139838 4:105306115-105306137 CTTTCTGTGGAACAGAGAAATGG - Intergenic
978880773 4:113700186-113700208 CCTTCTTGGGGGCAGGGAAATGG - Intronic
979526360 4:121721511-121721533 CCATCTTGGAAGCAGAGAGAAGG + Intergenic
981083831 4:140662295-140662317 CCTACTATGGAGCTGAAAGAGGG - Intronic
981439193 4:144763251-144763273 CCTACTTAAGAGTAGAGAGAGGG + Intergenic
981552458 4:145955903-145955925 CCTTCTTGGGGGCAAGGAGATGG + Intergenic
981907805 4:149942717-149942739 CATTCTCTAGAGCAGACAGAGGG + Intergenic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
985696458 5:1343599-1343621 CCTTCATGGAGGCAGAGAGAGGG + Intronic
986175215 5:5346525-5346547 CCTTCTTAGCAGCAGAGAGGGGG + Intergenic
986799632 5:11246062-11246084 CATTGTTTGGAGGAGTGAGAGGG - Intronic
987529091 5:19093944-19093966 ACTTCTTTGGAGGACAGAGAAGG + Intergenic
988363616 5:30267580-30267602 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
990028026 5:51220022-51220044 TCTTCTTTTGAGCTGAGAAAAGG + Intergenic
990684079 5:58279917-58279939 ACTTCTAGGAAGCAGAGAGAGGG + Intergenic
990776662 5:59311985-59312007 CCTCCTTTGGAGGTGAAAGAGGG + Intronic
992998235 5:82353686-82353708 CTGTCTTTTGAGCAGAGAGGTGG + Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
993934951 5:93987734-93987756 TCTTCTTTAGAGCAGATAAAAGG - Intronic
994722931 5:103401453-103401475 TATTCTCTGGAGAAGAGAGAAGG + Intergenic
996353122 5:122567708-122567730 CCTTTTTTGATGCAGAGAGTAGG - Intergenic
999135729 5:149317639-149317661 CCTTCTTTCCAGCAGACACATGG + Intronic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
999907792 5:156162683-156162705 CCATCTTCTGAGCAGGGAGAAGG - Intronic
999961074 5:156756204-156756226 CTTTCTTTGTAACAGAGAGGAGG + Intronic
1000520387 5:162287805-162287827 CATTCTTATGAGCAGAGTGAAGG + Intergenic
1001095424 5:168772118-168772140 CCTTCCTGGGTGCAGTGAGAAGG + Intronic
1002096030 5:176831522-176831544 CCTTCCATGGGGCAGAAAGAGGG - Intronic
1003833456 6:10040784-10040806 CCATCTTGGAAGCAGAGAGCAGG - Intronic
1004290699 6:14364229-14364251 CTTGCTTTTGAGGAGAGAGAGGG - Intergenic
1005506925 6:26477577-26477599 ACTTCCTTGGAACACAGAGAGGG + Intergenic
1006519781 6:34564605-34564627 ACTTGTTTGGAGCTGAGAGTTGG + Intergenic
1006683855 6:35815833-35815855 CCTTCTTTGGGGGTGAGAGAAGG + Intronic
1007376666 6:41461666-41461688 TCTTCTTGTGAGCAGAGAGCAGG - Intergenic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1008949600 6:57141376-57141398 CCTTCTTTTTAGCAGAAAGGAGG + Exonic
1009950296 6:70387541-70387563 CCTTCTTTCTAGCCGAGATAAGG - Intergenic
1011795258 6:90946089-90946111 GTTGCTTTGGAGCAGACAGATGG - Intergenic
1011837434 6:91450667-91450689 TCTGCTTTGGAGAAGAGAGGGGG - Intergenic
1013108555 6:107046890-107046912 GCTTCCTTGTAGCACAGAGAAGG - Intronic
1013365358 6:109433578-109433600 CCTTCTTTGGAGCAGAGAGAGGG + Intronic
1014254485 6:119147556-119147578 CCTTCTCTGGTACAGAGAGTGGG - Intronic
1014663905 6:124211145-124211167 GTTTCTTTGGAGGAGAGACAAGG - Intronic
1016071866 6:139748438-139748460 ACTCCCTTGGAGCAGAGATAGGG + Intergenic
1016568718 6:145489085-145489107 CCATCTCTGCAACAGAGAGAGGG - Intergenic
1018948302 6:168362416-168362438 CCTTGATTGGAAAAGAGAGAAGG - Intergenic
1019037742 6:169075956-169075978 CCTTCAATGGAGCAGAAAGTGGG + Intergenic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1020603946 7:10311267-10311289 CCTTCTTTGGAGCACAATCATGG + Intergenic
1021963085 7:25891931-25891953 ACTTCTTTGGAGCAGGGATATGG - Intergenic
1022739299 7:33106346-33106368 CCTTCTTTCTTGCAGAGATAAGG + Intronic
1023162810 7:37313692-37313714 CCTTCTTTGGGGTAGAGCAAGGG + Intronic
1024253133 7:47521222-47521244 CCTCCTTGGGAGCACAGAGGAGG - Intronic
1024267576 7:47618648-47618670 CCATCTTTGAAGCAGAGAATGGG + Intergenic
1025718196 7:63983352-63983374 CCTTGCTTGAAGAAGAGAGAGGG + Intergenic
1025762987 7:64412230-64412252 CCTTCTTTGGAGCACAGTGGGGG - Intergenic
1026182508 7:68054312-68054334 CCATCTATGAAGCAGAGAGCAGG + Intergenic
1026255443 7:68707276-68707298 CCTGCTAGGGAGAAGAGAGAGGG - Intergenic
1026438758 7:70424248-70424270 TCTTCTGTGGAGCAGAAATACGG + Intronic
1028009700 7:85625787-85625809 CCTACTTGAGAGCAGAGAGTGGG + Intergenic
1028835703 7:95372742-95372764 CCTTCCTCAAAGCAGAGAGAAGG + Intronic
1030679161 7:112416011-112416033 ACTTTTTTTGTGCAGAGAGAAGG + Intergenic
1032445069 7:131975141-131975163 CCATCTTGGGAGCAGAGACTGGG + Intergenic
1033558909 7:142512371-142512393 CCTTGTTTGGAGCAGTGAGCTGG - Intergenic
1033686783 7:143647423-143647445 CCATCTTGGGAGCACAGAGCAGG + Intronic
1033688951 7:143719884-143719906 CCATCTTGGGAGCACAGAGCAGG - Exonic
1033697826 7:143810191-143810213 CCATCTTGGGAGCACAGAGCAGG - Intergenic
1033725125 7:144107755-144107777 TTTTTTCTGGAGCAGAGAGAGGG - Intergenic
1034056878 7:148044621-148044643 CCATCTATGAAGCAGAGAGTCGG + Intronic
1035361672 7:158317643-158317665 CCTTCTTTGGTGCACACAAAAGG + Intronic
1036104801 8:5827981-5828003 CCTTCTTTGGACCAGACATTAGG + Intergenic
1036386391 8:8285426-8285448 CCTTACTTCGAGCAGAGAGAGGG - Intergenic
1038882083 8:31625927-31625949 CCATCTTTGGAGAAGAGAACAGG + Intergenic
1039102132 8:33951851-33951873 CCCTCTTTGGAGCAGTGCGGTGG + Intergenic
1039547619 8:38421191-38421213 CCCTCTTGGGAGAGGAGAGACGG + Intronic
1039766005 8:40628713-40628735 ACTAACTTGGAGCAGAGAGATGG + Intronic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1039939246 8:42075247-42075269 GATGCTTTGGGGCAGAGAGAGGG + Intergenic
1040590711 8:48789809-48789831 CCTTATTCGGAGCAGCGAAATGG + Intergenic
1040861179 8:52000795-52000817 CCTTGTTTGGAGGAGAGATTGGG - Intergenic
1040984563 8:53279667-53279689 CCATCTTAGAAGCAGAGAGATGG + Intergenic
1041242436 8:55859467-55859489 CCTCCTTGTGAGCAGAGGGAGGG + Intergenic
1041950440 8:63495306-63495328 CCTACCTTGGAGCAGATAAAAGG - Intergenic
1042361090 8:67884152-67884174 CCTGCTTTAGAGAAGAGAAATGG - Intergenic
1043027101 8:75083852-75083874 TCTTCTTTGGAGCAGGTAGGTGG + Intergenic
1043684384 8:83068287-83068309 CCTTCTCTGTAGCAGAAAAAAGG + Intergenic
1043808098 8:84699489-84699511 CCTTCTATTGACCAGAAAGAAGG - Intronic
1044216476 8:89617078-89617100 CCTTCTTCAAAGCAGGGAGATGG + Intergenic
1044738509 8:95302519-95302541 CCTTCTTTTGATGAAAGAGAAGG + Intergenic
1044776377 8:95693370-95693392 GCCTCTTTGGAACAGAGAGGAGG + Intergenic
1046829283 8:118726428-118726450 TCCTCTTTGGTGCAGAGAGAAGG - Intergenic
1047164643 8:122423607-122423629 CCTACTTGAGAGCAGAGAGAGGG - Intergenic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1049328108 8:142034567-142034589 ACTTCTTTGGTGCAGAGAGGTGG - Intergenic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1050193328 9:3053242-3053264 TCTTCTTTGGATAAGACAGAGGG + Intergenic
1050628667 9:7535946-7535968 CCTTCTTTGAGTCAGAGAGCAGG + Intergenic
1051352033 9:16206053-16206075 CCATCTTTGAAGCAGAGGCAAGG - Intronic
1051847075 9:21464008-21464030 CCTTATTTTGAGCATACAGATGG + Intergenic
1051870926 9:21736660-21736682 TCTTCTGTGGTGCAGAGAGCAGG - Intergenic
1053705819 9:40751746-40751768 CCTTCTTTGGATCAGACATTAGG + Intergenic
1053771657 9:41486303-41486325 CCTTCTTGGGAGTGGAGATAGGG - Intergenic
1054415895 9:64875350-64875372 CCTTCTTTGGATCAGACATTAGG + Intergenic
1055141642 9:72883217-72883239 CCTGCTTTGGGGGAGAAAGAAGG - Intergenic
1056846045 9:90039141-90039163 CCTTCTTCGGAGGAGACAGCTGG - Intergenic
1057207383 9:93181815-93181837 CCGTCTTAGCAGCAGGGAGATGG + Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059749338 9:117233133-117233155 CCTTCTGAGGGGCAGAGAGCAGG + Intronic
1060497487 9:124129303-124129325 CCTGCTCTGCAGCAGAAAGAGGG + Intergenic
1061207054 9:129170763-129170785 TGTTCTATGGAGCAGAGAGGAGG - Intergenic
1061373906 9:130212987-130213009 CCTCAACTGGAGCAGAGAGACGG - Intronic
1062388741 9:136325758-136325780 CCTTCCTTGATGCAGAGAGCTGG - Intergenic
1186070788 X:5817698-5817720 CCTTCTTTGGACCACTGATATGG - Intergenic
1187263483 X:17709115-17709137 TGGTCTTTGGAGAAGAGAGATGG + Intronic
1188507607 X:30899440-30899462 CCTTCCATAGAGCAGAGACAAGG - Intronic
1188660204 X:32749535-32749557 AATTCTTAGGAGCAGAGAGCAGG - Intronic
1189232236 X:39461465-39461487 CCTACATGGGAGCAGAGAGAAGG - Intergenic
1190061704 X:47215747-47215769 CCTACTTTGGAGAAGACAGCTGG + Intergenic
1190261967 X:48802852-48802874 GCTTCTGTGAATCAGAGAGAAGG - Exonic
1191785978 X:64917505-64917527 CCTTGTTTGGAGCTAAGGGAAGG - Exonic
1192051197 X:67725405-67725427 CCTTCTTTAGAGCAGCTAAAGGG + Exonic
1192773137 X:74214526-74214548 CCTTCTTTGTGGCGGGGAGATGG - Intergenic
1193299947 X:79878179-79878201 CCATCTTTGAAGCAGAGAGCAGG + Intergenic
1195001879 X:100650150-100650172 CCTGGTTTGGAGAACAGAGAAGG - Intronic
1195146687 X:102025812-102025834 CCTTCTTTGGAGAGGAGGTAAGG - Intergenic
1196569201 X:117245900-117245922 CCTGCTTTGGAGCATATAGGGGG + Intergenic
1197106165 X:122719143-122719165 CCATCTTGGAAGCAGAGTGAAGG - Intergenic
1197759125 X:130015389-130015411 GCTTCGCTGGAGCTGAGAGATGG - Exonic
1198410053 X:136357698-136357720 CATTAGTTGGAACAGAGAGAAGG + Exonic
1199099193 X:143779161-143779183 CCTTCTGTGCAGCACAGTGAAGG + Intergenic
1199848972 X:151711773-151711795 CCACCTTGTGAGCAGAGAGAGGG - Intergenic
1200367195 X:155679394-155679416 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
1202334477 Y:23792723-23792745 CCTTTTTTTGAGCACAGAGCTGG - Intergenic
1202350775 Y:23988424-23988446 CCTTTTTTTGAGCACAGAGCTGG - Intergenic
1202520004 Y:25681696-25681718 CCTTTTTTTGAGCACAGAGCTGG + Intergenic
1202536291 Y:25877336-25877358 CCTTTTTTTGAGCACAGAGCTGG + Intergenic