ID: 1013366368

View in Genome Browser
Species Human (GRCh38)
Location 6:109440968-109440990
Sequence AAGCCCGCGTGGCTCAGGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366368_1013366381 22 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366368_1013366380 21 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366368_1013366383 29 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366368_1013366382 23 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1013366368_1013366377 16 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366377 6:109441007-109441029 CGCCGCCTGCGAAGAAGGAACGG 0: 1
1: 0
2: 0
3: 9
4: 57
1013366368_1013366376 11 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366376 6:109441002-109441024 GTGCGCGCCGCCTGCGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366368 Original CRISPR AAGCCCGCGTGGCTCAGGTC GGG (reversed) Exonic
903773817 1:25780575-25780597 AAACCCTCTTGGCTGAGGTCTGG + Intronic
904089663 1:27935922-27935944 AAGCCCGCGTGGCTGAAGCAGGG + Intronic
906168504 1:43705537-43705559 GAGCCCACGTGGCCCACGTCAGG + Intergenic
906262929 1:44407051-44407073 ACGCGCGCCTGGCTCAGGGCCGG - Intronic
924343598 1:243055361-243055383 AAGCTCCCGAGGCCCAGGTCAGG - Intergenic
924680306 1:246224395-246224417 AAGCCAGTGTGGCTGAGGTGTGG + Intronic
1063541956 10:6943035-6943057 AAGCCCACCTGGCTCAGATGAGG + Intergenic
1069742420 10:70693390-70693412 AAGCCCCAGTGGCTCAGGAGGGG - Intronic
1084494147 11:69494432-69494454 AAGCCTTCATGGCTCAGGTGTGG - Intergenic
1085363234 11:75911690-75911712 AAGGCCGCGGGACTCAGGGCTGG + Intronic
1088755438 11:112881766-112881788 AAGCTGGCCTGGCTCGGGTCGGG - Intergenic
1090681004 11:129057338-129057360 AAACCAGCCTGGCTCAGGTAGGG + Intronic
1097167295 12:57092707-57092729 AAGTCAGCTTGTCTCAGGTCTGG + Intronic
1097790282 12:63808051-63808073 AAGCCAGGGTGGCTGAGGTAGGG - Intronic
1102581345 12:113890241-113890263 GAGCCAGCCTGGCTCAGCTCCGG - Intronic
1114319660 14:21536790-21536812 AAGCCTGTGTGGGTCAGGCCAGG - Intronic
1116820285 14:49620840-49620862 GAGGCCGCGTCGCTCAGTTCTGG + Exonic
1121951230 14:98172447-98172469 AAGCCAGCGTGGCTCTGCCCTGG - Intergenic
1122608503 14:102964424-102964446 GAGCCCGTGAGGCTCAGGGCGGG + Intronic
1128064110 15:64753883-64753905 AGGCCTGCTGGGCTCAGGTCAGG - Intronic
1128497017 15:68204481-68204503 AGGCTCCCCTGGCTCAGGTCTGG + Intronic
1132714416 16:1283697-1283719 GAGCCAGCGTGGCTGGGGTCTGG + Intergenic
1135240895 16:20806502-20806524 AAGCCCGCGAGGCTGAGGGGCGG + Exonic
1137253206 16:46755187-46755209 AAGCGTGCGTGGGTCAGGTGTGG - Intronic
1142003101 16:87675283-87675305 AAGCAGGCGTGGCTGAGGCCTGG - Intronic
1142768005 17:2076490-2076512 AAGCCCCCGTGGTTCTGGGCAGG + Intronic
1144711289 17:17403364-17403386 AAGGCCGTGTGGCTCAGGTTAGG + Intergenic
1144846845 17:18224692-18224714 TAGGCCGCCTGGCTCAGGGCTGG - Intergenic
1146265250 17:31448615-31448637 GACCCCGCGTGGCTGAGGCCTGG + Intronic
1148438432 17:47699401-47699423 AGGCCCGGGGGGCTCAGCTCCGG + Exonic
1152544551 17:80994247-80994269 AAGCACTCTAGGCTCAGGTCAGG - Intronic
1158357580 18:56638376-56638398 GAGCCCGCGCCGCTCAGCTCTGG + Exonic
1158567522 18:58567852-58567874 AAGCCCGTGTGTCTAAGGGCAGG + Intronic
1161154311 19:2724216-2724238 AGGCCCACGTGGCCCTGGTCAGG - Intronic
1161221945 19:3121956-3121978 AAGCCCCCGTGGCTCCAGCCCGG - Exonic
1162440485 19:10689120-10689142 CAGCCAGCGGGGCTCAGGTTAGG - Intronic
1164739743 19:30567191-30567213 CAGCCCGCCAGGCTCATGTCAGG + Intronic
1166549341 19:43654844-43654866 AAGTCAGCGTGGCTCAGCCCAGG + Intronic
1167269982 19:48501173-48501195 AGGCCCGGGTGGGTCAGGGCTGG - Intronic
1168224327 19:54983340-54983362 TAGCCTGCTTGGATCAGGTCGGG - Exonic
929561344 2:42958398-42958420 AAGTCTGCGTGGCTCCGGCCAGG + Intergenic
932431923 2:71681207-71681229 AAGCCCACGTGGCTCAGAGAGGG + Intronic
936007710 2:108905660-108905682 AATCCCTCATGGCTGAGGTCAGG - Intronic
937957570 2:127430215-127430237 AAGCCGGCCTGGCTCAGTCCAGG - Intergenic
940761924 2:157748255-157748277 AGGCCTGCTTGGCTCAGCTCTGG + Intronic
946373610 2:219295157-219295179 CAGCCCGCGGCGCTCAGGCCTGG - Intronic
1172612157 20:36260324-36260346 AAGTGCACCTGGCTCAGGTCTGG + Intronic
1173196760 20:40920461-40920483 AAGCCTGATTGGCTCAGGTGGGG - Intergenic
1177821183 21:26032447-26032469 AAACCCACGTGGCTGAGCTCTGG - Intronic
1179586453 21:42376650-42376672 ACGGCCGCGTGGTTCAGGACAGG + Exonic
1180087694 21:45515431-45515453 AAGCCCGCGGGGCACAGTGCAGG + Exonic
1180099611 21:45578403-45578425 GAGCCCCCGTGGCTAAGGACGGG - Intergenic
1184525485 22:45020206-45020228 CAGCCCAGGTGGCTGAGGTCAGG + Intergenic
951595347 3:24312681-24312703 AAGCCAGCGTGGCTCAGCCATGG + Intronic
952191258 3:31025706-31025728 AGGCCAGTGTGGCTGAGGTCAGG - Intergenic
957315332 3:78569272-78569294 AGGCCCAAGTGGCTCAGGTATGG - Intergenic
968541097 4:1168836-1168858 AAGCCAGCCTGGCTCAGCTCTGG - Intronic
968876150 4:3269018-3269040 AAGCCAGCGTAGATCAGGTCTGG + Intronic
969288405 4:6222445-6222467 AGGCCCGCGGCGCGCAGGTCAGG + Intergenic
969409653 4:7019744-7019766 AACCCCGCTGGGCTCAGGTCAGG + Intronic
969409684 4:7019852-7019874 AACCCCGCTGGGCTCAGGTCAGG + Intronic
969409698 4:7019906-7019928 AACCCCGCTGGGCTCAGGTTAGG + Intronic
969409715 4:7019960-7019982 AACCCCGCTGGGCTCAGGTCAGG + Intronic
983495170 4:168435269-168435291 AAGCCCTCGTTCCACAGGTCAGG - Intronic
985671666 5:1209999-1210021 AAGCCCCCGTGGCCCAGGACAGG - Intronic
1002212669 5:177608055-177608077 AAGCACTTGTGGCTCAGGCCTGG + Intronic
1006436785 6:34029855-34029877 AGGCTGGCGTGGCCCAGGTCAGG + Intronic
1013366368 6:109440968-109440990 AAGCCCGCGTGGCTCAGGTCGGG - Exonic
1019058775 6:169241246-169241268 ATGCCTGCGGGGCTCAGGACGGG - Intronic
1019471999 7:1226022-1226044 CAGCCCGCGTGGCCCGGGCCGGG + Intergenic
1035226786 7:157438180-157438202 AAGCCAGCATGGCTCAGGAGGGG - Intergenic
1035394633 7:158527084-158527106 AAGCCAACCTGGCTCAGGCCTGG + Intronic
1036032724 8:4991703-4991725 AAGCCCGGGTGACCAAGGTCGGG - Intronic
1037921648 8:22810499-22810521 AAGCCCGGGTTCCTCATGTCAGG + Intronic
1049152289 8:141042768-141042790 AACCCAGCCTGGCTCAGGGCTGG - Intergenic
1049320286 8:141992582-141992604 AGGCCTGCCTGGATCAGGTCAGG + Intergenic
1049366475 8:142239221-142239243 AAGCCCACCTGGCTAAGGTTTGG - Intronic
1049961081 9:738811-738833 AAGCCCGCATGATTCAGCTCAGG - Intronic
1056684937 9:88751885-88751907 AAGGCCGGGAGGCCCAGGTCTGG + Intergenic
1060406550 9:123375811-123375833 AACCCCGGGTGGCTCAGCCCAGG + Intronic
1189701860 X:43720532-43720554 AAGCCCTCGTGGCTCATTCCTGG - Intronic
1192264821 X:69530974-69530996 AAGCCCAAGTGGGTCAGGCCTGG + Exonic
1196782925 X:119399360-119399382 AAGACCGCGTGGCTCGGGCCTGG - Exonic