ID: 1013366369

View in Genome Browser
Species Human (GRCh38)
Location 6:109440969-109440991
Sequence CAAGCCCGCGTGGCTCAGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366369_1013366380 20 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366369_1013366381 21 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366369_1013366376 10 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366376 6:109441002-109441024 GTGCGCGCCGCCTGCGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 35
1013366369_1013366383 28 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366369_1013366377 15 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366377 6:109441007-109441029 CGCCGCCTGCGAAGAAGGAACGG 0: 1
1: 0
2: 0
3: 9
4: 57
1013366369_1013366382 22 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366369 Original CRISPR CAAGCCCGCGTGGCTCAGGT CGG (reversed) Exonic
901008101 1:6181264-6181286 CGATCCTGCGTGTCTCAGGTGGG - Intronic
901886919 1:12230025-12230047 CAGGCCCGCGGCGCTCAGGCCGG - Intergenic
902626598 1:17680108-17680130 CAACCCCGGGTGGCCCAGATGGG - Intronic
903273155 1:22204664-22204686 GAAGCCAGCTTGGCTCAGGCTGG - Intergenic
903750084 1:25616390-25616412 CCCGCCCGCGAGGCTCGGGTTGG - Intergenic
904089662 1:27935921-27935943 GAAGCCCGCGTGGCTGAAGCAGG + Intronic
906320776 1:44813941-44813963 CAAGCCCGTGTGGGCGAGGTGGG + Exonic
906637193 1:47417226-47417248 GAAGCCCGGCTGCCTCAGGTAGG - Exonic
907460887 1:54604805-54604827 CAAGCCCCAGTGGCACAGGCAGG - Intronic
1065125154 10:22566789-22566811 CAAGGGCGCCTGGCTCAGGCTGG - Intronic
1067095826 10:43298892-43298914 CCAGCCAGCGAGGCCCAGGTTGG - Intergenic
1069742421 10:70693391-70693413 GAAGCCCCAGTGGCTCAGGAGGG - Intronic
1074459814 10:113626546-113626568 CAAGCAAGGGTGGCTCAGGTTGG - Intronic
1076804343 10:132847595-132847617 CAGGCCCACGTGACTCAGGCCGG - Intronic
1079152290 11:17910889-17910911 GAGGGCCTCGTGGCTCAGGTGGG + Intronic
1085051537 11:73382576-73382598 CAGGCCTGGGTGGCTCAGGCAGG + Intronic
1086080310 11:82897010-82897032 CTAGCCTGAGGGGCTCAGGTGGG + Intronic
1088755439 11:112881767-112881789 CAAGCTGGCCTGGCTCGGGTCGG - Intergenic
1090274862 11:125412016-125412038 CAGGCCAGGGGGGCTCAGGTGGG + Intronic
1090681003 11:129057337-129057359 GAAACCAGCCTGGCTCAGGTAGG + Intronic
1091883206 12:3996600-3996622 CAAGCCAGTGTGGCTCAGTGAGG + Intergenic
1094008823 12:25784978-25785000 CCAGCCCACTTGCCTCAGGTGGG + Intergenic
1097790283 12:63808052-63808074 GAAGCCAGGGTGGCTGAGGTAGG - Intronic
1104807102 12:131596629-131596651 CATCCCGGCGTGTCTCAGGTAGG + Intergenic
1105051228 12:133052931-133052953 GAAGCCCATGTGGCTGAGGTTGG + Intronic
1110219600 13:73059262-73059284 CAAGCCAGCGTGGGCGAGGTGGG + Exonic
1114008027 14:18334027-18334049 CAAGACCTCGGGGCTCAGGACGG - Intergenic
1121904021 14:97723393-97723415 CAAGCCCAGGTGGATGAGGTGGG + Intergenic
1123069709 14:105636514-105636536 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1123088791 14:105732233-105732255 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1123094729 14:105761556-105761578 CAAGCCCACTTGGGTCACGTGGG + Intergenic
1135059934 16:19262817-19262839 CAAGCTGGCATGGCTCAGGCAGG + Intronic
1136587688 16:31198137-31198159 CGAGCCACCGTGGCTGAGGTGGG - Intergenic
1139263974 16:65622490-65622512 TGAGCCCGCGTGGCTCTGTTTGG - Intergenic
1139950149 16:70664574-70664596 CAGGCCCGCGGGGCTGGGGTGGG - Intronic
1141502797 16:84455285-84455307 AATGCCCGCCTGGCTCAGGCTGG + Intronic
1142509550 17:385500-385522 CAACCCCGCGGGACTCAGGCTGG + Intronic
1143686155 17:8517715-8517737 CAAGGCCGCCTGGCTGCGGTAGG - Intronic
1146639123 17:34526939-34526961 CAAGCCCATGTGTCTCAGGAAGG + Intergenic
1149537635 17:57444735-57444757 CAAGGCCTGGTGGCCCAGGTAGG + Intronic
1152700290 17:81815200-81815222 CCAGCCCACGTGGCCCAGGCAGG - Intergenic
1160422754 18:78758867-78758889 CAGACCCACCTGGCTCAGGTAGG + Intergenic
1163693255 19:18749186-18749208 CAAGACCTCCTGCCTCAGGTTGG + Intronic
1165141326 19:33701863-33701885 GAAGCCTGCGTGGCTCAGCCAGG + Intronic
1165827956 19:38716349-38716371 CAAGCCCACCTGGCTCAGTCTGG - Intronic
1165960895 19:39533368-39533390 CCAGGCCGAGTGGCTCAGGCCGG - Intergenic
1166558924 19:43719271-43719293 CAGGCCAGCGTGGCGCCGGTGGG - Exonic
1167449213 19:49557076-49557098 CCAGCCCAGGTGACTCAGGTTGG - Exonic
925923070 2:8650963-8650985 CCAGCCCCAGTGGCTCAGCTTGG - Intergenic
927092471 2:19722541-19722563 CCAGCCTGCATGGCTCAGGTGGG - Intergenic
932431922 2:71681206-71681228 AAAGCCCACGTGGCTCAGAGAGG + Intronic
938069260 2:128299919-128299941 CAAGGCAGGGTGGCTCTGGTGGG + Intronic
946406105 2:219492857-219492879 CAGGCCCGCCTGGCTCAGCGTGG - Exonic
947748592 2:232521853-232521875 CAACCTCACCTGGCTCAGGTGGG - Exonic
1169995535 20:11552180-11552202 CCAGCCCCCTTGCCTCAGGTGGG - Intergenic
1172274710 20:33673405-33673427 CAAGCCAGGGAGGCCCAGGTAGG + Intronic
1173196761 20:40920462-40920484 TAAGCCTGATTGGCTCAGGTGGG - Intergenic
1176457574 21:6927814-6927836 CAAGCCCCAGTAGCTCAGGCAGG - Intergenic
1176835746 21:13792898-13792920 CAAGCCCCAGTAGCTCAGGCAGG - Intergenic
1181068623 22:20319128-20319150 CAAGCAGGCCTGGCTCAAGTGGG + Intronic
1181084072 22:20431254-20431276 CCAGCCTGCGTGGCACAGGCAGG + Exonic
1184250228 22:43255965-43255987 CAGACCCCCGTGGCTCAGGCTGG + Intronic
954532905 3:51336387-51336409 CAAGCCCTTGTGGCTCAGAGTGG + Intronic
968810647 4:2798302-2798324 AAAGCCCTGGTGGCACAGGTAGG - Intronic
969409730 4:7020013-7020035 GAACCCCGCTGGGCTCAGGTCGG + Intronic
976064103 4:81164035-81164057 CAAGCACACCTGGATCAGGTGGG + Intronic
976597619 4:86908841-86908863 CCAGCCCTCCTGGCACAGGTGGG + Intronic
985231280 4:187820884-187820906 CACCCCAGCGTGGCTCAAGTGGG + Intergenic
993178508 5:84518855-84518877 CAAGCAGGCGTGGCTCAGTTGGG + Intergenic
994244091 5:97459006-97459028 CAAGCTCTCGAGGCACAGGTGGG + Intergenic
1006209129 6:32377770-32377792 CAAGCCTACGTGGCTTAGATGGG + Intergenic
1013366369 6:109440969-109440991 CAAGCCCGCGTGGCTCAGGTCGG - Exonic
1019410350 7:904053-904075 CAGGCCCGGGTGGCGCAGGAAGG - Intronic
1019653260 7:2172277-2172299 CAAGCACACGAGGCTCGGGTGGG + Intronic
1020130126 7:5555073-5555095 CAGGCCCGCGCGGCTCACGTGGG + Intronic
1021925417 7:25529515-25529537 CAAGCATGCGTGGCACAGGATGG + Intergenic
1029252574 7:99247586-99247608 CAAGCCCGAGTAGGTCTGGTGGG - Intergenic
1033659134 7:143391736-143391758 CCAGCCTGAGTGGCTCAGATGGG - Exonic
1035226787 7:157438181-157438203 GAAGCCAGCATGGCTCAGGAGGG - Intergenic
1037800811 8:22034258-22034280 CAGGCGAGCGTGGCTAAGGTGGG + Exonic
1047391123 8:124452091-124452113 CAAGCCAGAGTGGCAAAGGTGGG + Exonic
1048857667 8:138698114-138698136 CAACCCCGAGGGGCTCAGGGTGG + Intronic
1049198509 8:141328497-141328519 CAAGCCAGCGGGGCTGAGGCAGG + Intergenic
1049451440 8:142664253-142664275 CATGCCCTCCTGCCTCAGGTGGG + Intronic
1057490766 9:95517619-95517641 CAAGGCCGCCTGGCACAGGACGG - Intergenic
1062439494 9:136563372-136563394 CCAGCCCGCGTGGCTAGGCTGGG + Intergenic
1186417556 X:9397068-9397090 CAAGCAGGCGTGGATAAGGTGGG + Intergenic
1200846857 Y:7839207-7839229 AAGGCCCGAGTGGCTTAGGTGGG - Intergenic
1201951203 Y:19566671-19566693 CAAGCCCGCGTGGGTCAGCGGGG + Intergenic