ID: 1013366369

View in Genome Browser
Species Human (GRCh38)
Location 6:109440969-109440991
Sequence CAAGCCCGCGTGGCTCAGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366369_1013366380 20 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366369_1013366377 15 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366377 6:109441007-109441029 CGCCGCCTGCGAAGAAGGAACGG 0: 1
1: 0
2: 0
3: 9
4: 57
1013366369_1013366381 21 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366369_1013366382 22 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1013366369_1013366383 28 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366369_1013366376 10 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366376 6:109441002-109441024 GTGCGCGCCGCCTGCGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366369 Original CRISPR CAAGCCCGCGTGGCTCAGGT CGG (reversed) Exonic