ID: 1013366371

View in Genome Browser
Species Human (GRCh38)
Location 6:109440973-109440995
Sequence GCACCAAGCCCGCGTGGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366371_1013366380 16 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366371_1013366377 11 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366377 6:109441007-109441029 CGCCGCCTGCGAAGAAGGAACGG 0: 1
1: 0
2: 0
3: 9
4: 57
1013366371_1013366381 17 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366371_1013366382 18 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1013366371_1013366383 24 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366371_1013366376 6 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366376 6:109441002-109441024 GTGCGCGCCGCCTGCGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366371 Original CRISPR GCACCAAGCCCGCGTGGCTC AGG (reversed) Exonic
900657588 1:3767406-3767428 GCAGCACACCCGCGTGGCCCTGG + Exonic
901631850 1:10651919-10651941 CCACCGAGCCCACGTGGCCCTGG + Intronic
906065951 1:42980240-42980262 GCACCAAGCACACCTGGCTCTGG + Intergenic
914088544 1:144475561-144475583 GCCCCAAGCCCCCGGGGCTGTGG - Intergenic
914379763 1:147105537-147105559 GCCCCAAGCCCCCGGGGCTGTGG - Intergenic
914592042 1:149114490-149114512 GCCCCAAGCCCCCGGGGCTGTGG - Intergenic
921017012 1:211201331-211201353 GCACAAAGCCAGCCTGACTCTGG + Intergenic
1064384757 10:14879606-14879628 GCACCGAGCGCGCGTGGGTGTGG + Intronic
1065342677 10:24722697-24722719 GCACAAAGCCAGCCTGGCTGGGG + Intronic
1079278907 11:19070528-19070550 CCACCAAGCCCTATTGGCTCAGG - Intergenic
1079353428 11:19712526-19712548 GAGCCGTGCCCGCGTGGCTCTGG + Intronic
1080849154 11:36053065-36053087 GCTCCAAGCCCCCATGGCTCAGG - Intronic
1083298458 11:61727809-61727831 GAATCAAGGCCGGGTGGCTCTGG - Intronic
1083364623 11:62133952-62133974 TGACCAAGCCCCCATGGCTCAGG + Intronic
1085460259 11:76689222-76689244 GCACCAGGCTCCCGTAGCTCTGG - Intergenic
1095356426 12:41280503-41280525 GCACCAAGCTCGAGTGTCCCAGG - Intronic
1096509563 12:52120156-52120178 GCACCACGCCCGCCTGGAACAGG - Intergenic
1097159643 12:57037346-57037368 GCACCAAGCTCCCCAGGCTCAGG + Intronic
1097989988 12:65824496-65824518 GCACCAAGCGCGCGCTGCCCGGG - Exonic
1103487969 12:121296033-121296055 GGACCAAGCCTGTGAGGCTCCGG + Intronic
1113378696 13:109785036-109785058 GCACCAGGCCCGTCTGGCTGGGG + Exonic
1113602941 13:111583981-111584003 GGCCCAAGGCCACGTGGCTCAGG + Intergenic
1116943356 14:50812329-50812351 CCAGCAAGCCTGCCTGGCTCAGG + Intronic
1118455855 14:65945358-65945380 GCAGCAGGCCACCGTGGCTCAGG + Intergenic
1122207744 14:100156654-100156676 GCTCCAAGCCCTCTGGGCTCTGG - Intronic
1122722332 14:103729204-103729226 GCACCAAACCCTCCTGGCTTAGG - Intronic
1129184605 15:73898213-73898235 TCACCAGGCCCGTGTGGCACAGG + Intergenic
1129516543 15:76160844-76160866 GCACCAAGCCCGGGGGCCTGCGG - Intronic
1130411834 15:83654221-83654243 GCGCCGAGCCCGCGCGGCCCCGG + Exonic
1132734574 16:1379223-1379245 GCACTCAGCCCGCGTGGTACGGG - Intronic
1132830725 16:1926758-1926780 GCACCCAGCCCACCTGGTTCTGG + Intergenic
1136274431 16:29170018-29170040 GCACCAAGCCGGTGTCGCTGAGG - Intergenic
1138010279 16:53373064-53373086 GCGCCAGGCCCGCGGGGCTATGG + Intergenic
1138560434 16:57797919-57797941 GCTCCACGCCCGCCTGGCTCTGG + Intronic
1140487865 16:75308270-75308292 GCATCAAGCCCTCGTGGCCTTGG + Intronic
1144678351 17:17176129-17176151 GGACCAAGCCCGCGAGAATCAGG - Intronic
1147525261 17:41216456-41216478 GCACCAAGCTCGAGTGTCCCAGG - Intronic
1147768466 17:42852060-42852082 GCTCCAAGCCCACGTGGTGCAGG - Exonic
1147771054 17:42867992-42868014 GCTCCAAGCCCACGTGGTGCAGG - Intergenic
1149983793 17:61332112-61332134 CCACCCAGCCCGCCGGGCTCTGG + Intronic
1151505652 17:74525354-74525376 GCACCAACCCAGAGTAGCTCTGG - Intronic
1152085099 17:78213276-78213298 GCACCAGGCCTGCGTGGGGCTGG + Intergenic
1160941464 19:1622164-1622186 GCCCGAAGCCCGCCTGGCCCGGG + Exonic
1161105833 19:2443531-2443553 GAGCCAGGCCTGCGTGGCTCTGG + Intronic
1161649194 19:5473913-5473935 GCACCTAGCCAGCTGGGCTCGGG - Intergenic
1163773268 19:19203405-19203427 GCGCCAAGCCCACGCGGTTCCGG - Exonic
925578424 2:5384703-5384725 GCACCAGCCCCTCGTGGCTGTGG - Intergenic
926754608 2:16225133-16225155 GCTGGAAGCCCACGTGGCTCAGG + Intergenic
927506251 2:23616785-23616807 GCACCAAGTCTGTGTGACTCTGG + Intronic
930476650 2:51891236-51891258 TCACCAAGCCCGAGTGCCCCAGG + Intergenic
930971794 2:57405124-57405146 GGACCAAGGCCAAGTGGCTCAGG - Intergenic
934308404 2:91843760-91843782 GCACCTAGCCCGCAAGGCCCTGG + Intergenic
935306568 2:101742427-101742449 GCACACAGGCAGCGTGGCTCAGG - Intronic
936403265 2:112182105-112182127 GAACCAAGCGCGTGTGGCTTGGG - Intronic
940875878 2:158896559-158896581 GCAGCAGGCCCACGTGGCCCTGG - Intergenic
1170571853 20:17637144-17637166 GCACCAAGCCCTGATGGCTAGGG + Intronic
1173869782 20:46334158-46334180 ACACCAAGCCCGCGGAGCTCCGG + Intergenic
1179511459 21:41876787-41876809 GCAGCAGGCCTGCCTGGCTCTGG + Intronic
1179914310 21:44466669-44466691 GCTCCTAGCCAGCGTGGCCCTGG - Intergenic
1180535489 22:16390840-16390862 GCACCTAGCCCGCAAGGCCCTGG + Intergenic
1181590584 22:23882672-23882694 ACACCAAGCCCCCGGGGCCCAGG - Intronic
1185060370 22:48603389-48603411 GCAGCAAGCACGTGTGGCTGGGG + Intronic
1185331020 22:50252049-50252071 GCCACAAGTCAGCGTGGCTCCGG + Intronic
956290487 3:67654881-67654903 GCCCCAAGACCGCAGGGCTCGGG - Intergenic
968138120 3:196233820-196233842 GCACCAACCACGCGGGGCCCTGG + Intronic
968491738 4:893810-893832 GCACAGACCCCGCGTGGCTCTGG - Intronic
980716588 4:136637170-136637192 GCAGCAGGCACGCGTGGCTCAGG + Intergenic
982060275 4:151597880-151597902 GCACCAAGCTCGAGTGTCCCAGG + Intronic
987108548 5:14664241-14664263 GGCCCAAGCCCGCTGGGCTCGGG + Intergenic
990745853 5:58958938-58958960 CCACCAAGCCCGAGTGCCCCAGG + Intergenic
1004320862 6:14630421-14630443 GGACCAAGCCCCCAGGGCTCTGG + Intergenic
1006437411 6:34033167-34033189 GCACCAGGGCTGCTTGGCTCAGG + Intronic
1007665012 6:43508838-43508860 CCACCCTGCCCTCGTGGCTCTGG - Exonic
1013366371 6:109440973-109440995 GCACCAAGCCCGCGTGGCTCAGG - Exonic
1013656675 6:112253979-112254001 GAGCGAACCCCGCGTGGCTCTGG - Exonic
1017949672 6:159126226-159126248 ACACCCAGCCCCCGTGGCCCTGG + Intergenic
1019486222 7:1290630-1290652 ACACCAAGCCAGAGTTGCTCGGG + Intergenic
1019526201 7:1481599-1481621 TCACCGAGCCCACGTGGCCCAGG - Intronic
1019526223 7:1481671-1481693 TCACCGAGCCCACGTGGCCCAGG - Intronic
1019526255 7:1481779-1481801 TCACCGAGCCCACGTGGCCCAGG - Intronic
1019623711 7:2004673-2004695 GCAGCCTGCCCGCGTGGCGCCGG - Intronic
1019681807 7:2354784-2354806 GCACCAAGGCCGCGGGGCGGGGG - Intronic
1023867244 7:44244124-44244146 CCACCAAGTCCCCCTGGCTCTGG + Intronic
1024137146 7:46421483-46421505 GCACCAAGCCAGGGTGCCACAGG + Intergenic
1026488139 7:70838464-70838486 GCACCAAGCTCGAGTGTCCCAGG - Intergenic
1027472382 7:78589410-78589432 GGACCCAGCCAGCCTGGCTCTGG + Intronic
1034202346 7:149290314-149290336 GCACCAAGACGGCCTGTCTCAGG - Intronic
1034715114 7:153234842-153234864 CCACCAAGCTCGAGTGTCTCTGG + Intergenic
1035600424 8:893991-894013 TCACCCAGGCCGTGTGGCTCAGG + Intergenic
1036033380 8:4994701-4994723 GCACCAAGGCGGCGAGGCTGCGG + Exonic
1038577915 8:28721276-28721298 GCACCAAGCATGCATGGCTTAGG + Intronic
1038661704 8:29503183-29503205 GCACCAAGTTCTCCTGGCTCTGG + Intergenic
1041574749 8:59381190-59381212 CCACCAAGCTCGAGTGTCTCAGG - Intergenic
1042174589 8:66026695-66026717 GCACCAACGCCCCTTGGCTCTGG - Intronic
1052366197 9:27614784-27614806 ACACCAAGCCCGGGCGTCTCAGG + Intergenic
1062513387 9:136920335-136920357 GCTCTGACCCCGCGTGGCTCTGG - Exonic
1185464208 X:345719-345741 GCCCCAAGTCCGCCTGGCTGCGG + Intronic
1185893312 X:3838520-3838542 TCGCCAAGCCCGCGCGCCTCTGG + Intronic
1185898426 X:3876944-3876966 TCGCCAAGCCCGCGCGCCTCTGG + Intergenic
1185903541 X:3915373-3915395 TCGCCAAGCCCGCGCGCCTCTGG + Intergenic
1189491825 X:41475970-41475992 GCAGCAAGCATGCATGGCTCTGG + Intergenic
1191252115 X:58264716-58264738 GCGCCATGCCCGCGAGGTTCGGG + Intergenic
1197880754 X:131164261-131164283 CCACCAAGCTCGAGTGTCTCTGG + Intergenic
1200111623 X:153743688-153743710 GCACCTAGCCCGCAAGGCCCTGG + Exonic