ID: 1013366372

View in Genome Browser
Species Human (GRCh38)
Location 6:109440979-109441001
Sequence AGGTGGGCACCAAGCCCGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366372_1013366380 10 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366372_1013366377 5 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366377 6:109441007-109441029 CGCCGCCTGCGAAGAAGGAACGG 0: 1
1: 0
2: 0
3: 9
4: 57
1013366372_1013366382 12 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1013366372_1013366381 11 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366372_1013366376 0 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366376 6:109441002-109441024 GTGCGCGCCGCCTGCGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 35
1013366372_1013366384 27 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366372_1013366383 18 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366372 Original CRISPR AGGTGGGCACCAAGCCCGCG TGG (reversed) Exonic
900671295 1:3856792-3856814 AGGTGGGGACCGCGCCCCCGCGG + Intronic
901446093 1:9308976-9308998 GGGCGGGCACCAGGCCTGCGTGG + Intronic
903656475 1:24951611-24951633 ACGTGGGAACCAAGCTCGTGGGG + Intronic
905884095 1:41482441-41482463 AGGTGGGCACCCAGCCTGCAGGG - Intronic
917974372 1:180229819-180229841 TCGTGGGTTCCAAGCCCGCGCGG - Intergenic
918578483 1:186095371-186095393 AGATGGGCATCAAGCCCCAGAGG - Exonic
1062869685 10:889324-889346 AGGTGGGAACCATCCCCGAGAGG + Intronic
1064384755 10:14879600-14879622 AACTGGGCACCGAGCGCGCGTGG + Intronic
1066058974 10:31705919-31705941 AGGTGGGCACAGAGCCAGCCTGG - Intergenic
1077298873 11:1838195-1838217 AGGAGGGCCCCAAGCCCCCACGG + Intergenic
1084871059 11:72098760-72098782 AGGTGAGCACCTGGCCAGCGTGG - Exonic
1089528404 11:119111569-119111591 AGAAGTGGACCAAGCCCGCGAGG + Exonic
1089712441 11:120325398-120325420 GGGTGGGCACGGGGCCCGCGCGG + Intronic
1091543840 12:1487171-1487193 TGGGGTGCACCAAGGCCGCGTGG + Intronic
1093704948 12:22264407-22264429 AGCTGGGCACCATGCTCGCTAGG - Intronic
1125605238 15:40936544-40936566 AGCTGGGCGGCAAGCCCACGGGG - Exonic
1129737142 15:77972797-77972819 AGAGGGGCACCAAGCCCTCCTGG + Intergenic
1132229339 15:100170103-100170125 ACGTGGGCACCAAGTCCACATGG + Intronic
1132583715 16:696752-696774 AGGTGTGCACCAGGCTCGGGGGG - Exonic
1133030360 16:3007991-3008013 AGGTGGGCAGTGAGCCCGTGAGG + Intergenic
1138351499 16:56348429-56348451 AGGTGGCCACCAAGCTCTCCAGG - Intronic
1139546887 16:67653654-67653676 GTGTGGGCTGCAAGCCCGCGGGG + Intronic
1145815670 17:27793529-27793551 CGGTGGGCTCCGAGCCCGGGCGG - Intronic
1147423201 17:40332572-40332594 TGGTGGGCACCCAGCCAGTGCGG - Intronic
1148448641 17:47758138-47758160 AGATGGGAACCAAGCCTGTGAGG + Intergenic
1150656681 17:67044230-67044252 AGGTGGGCAGCAGGGCCCCGGGG - Intergenic
1151482652 17:74379533-74379555 AGGTGGGCAGAAAACCCGCCAGG - Intergenic
1151815885 17:76471194-76471216 TGGTGGGCACCCAGCCCTGGGGG + Exonic
1152745325 17:82036161-82036183 AGGTGGGAGCCCAGCCAGCGTGG - Intronic
1152756619 17:82089673-82089695 AGGCGGGCACCACGCCCGGGGGG + Exonic
1153678292 18:7475851-7475873 AGGTGGGCACATAGCAAGCGAGG - Intergenic
1154304139 18:13218250-13218272 AGCTGGGCGCCGAGCGCGCGAGG + Intronic
1161208870 19:3056185-3056207 GGCTGGGCACCAAGCCAGCCCGG - Intronic
1163574286 19:18101464-18101486 TGCTGGGCACCAAGCCCGGTTGG - Intronic
1163674677 19:18649631-18649653 AAGTGGGGGCCAAGCCCGCTGGG + Intronic
1166043926 19:40218425-40218447 GGGTGGGGACCAGCCCCGCGGGG - Intergenic
1166067187 19:40366736-40366758 AGGTGGTCAGCCAGCCCGAGGGG - Intronic
1166746010 19:45142210-45142232 CGGTGAGCCCCAAGCCCGGGAGG + Exonic
1168270474 19:55247178-55247200 AGGTGGGCACTCAGCCCCTGTGG - Intronic
924980321 2:213996-214018 CTGTGGGCATCAAGCTCGCGTGG + Intergenic
926249773 2:11147952-11147974 AAGTGGGCACCAAGCCTGCAGGG + Intergenic
929057542 2:37891346-37891368 TGGTGGGGACCAAGCACACGAGG - Intergenic
929581098 2:43082255-43082277 AGGTGGTCACCAAGCGGGCCAGG + Intergenic
932314684 2:70772039-70772061 AGTTGGGAAGCAAGCCCGGGAGG - Intergenic
932412596 2:71556082-71556104 AGGTGGGCACCAGGGGCGCCAGG - Intronic
937060736 2:118978587-118978609 GGATGGGAACCAAGCCCGCCTGG - Intronic
938081757 2:128373953-128373975 AGGTGGGCACCCGGCCTGCCAGG - Intergenic
940140377 2:150486065-150486087 AGGTGGGCACCGAGGCACCGCGG + Intronic
943942689 2:194020171-194020193 AGGTGGGAACCAGGGCTGCGCGG + Intergenic
948772246 2:240257594-240257616 AGCTGGGAACGAAGCCTGCGGGG - Intergenic
1169367282 20:5001559-5001581 AGGTGGGCCCCAGACCGGCGCGG - Intronic
1171778312 20:29392776-29392798 AGGAGGGCACCATGCCAGAGAGG - Intergenic
1172162187 20:32876310-32876332 TGGTGGGCACCACAGCCGCGTGG - Intronic
1173422127 20:42910654-42910676 TTGTGGGCACCAAGGCTGCGTGG - Intronic
1173837417 20:46134964-46134986 AGCTGGGCACCAAGGCCCAGAGG - Intergenic
1176091381 20:63319985-63320007 AGGTGGGCACCGGCCCCGCCTGG + Intronic
1178437847 21:32575416-32575438 GGGTGGGCAGGAAGCCCGGGGGG + Intergenic
1178922369 21:36747255-36747277 AGGTAGCCACCAACCCCGTGTGG + Intronic
1179445473 21:41427259-41427281 AGGTGGGCGGCAAGGGCGCGAGG - Exonic
1181266737 22:21635071-21635093 AGGTGGGCTCCAAGCTGGTGGGG - Exonic
950940282 3:16884680-16884702 GGGTGGGCGCCCGGCCCGCGCGG + Intronic
951954780 3:28241872-28241894 AGGTCGGCATCCAGCCCGCATGG - Intronic
953572594 3:44083082-44083104 AGGTGGGCACCCACCCCTCCTGG + Intergenic
953879482 3:46684187-46684209 AGGTGGGGAGCAAGCCAGAGGGG - Intronic
954110799 3:48431696-48431718 GGGTGTGCACCCAGCCCCCGTGG + Intergenic
954293458 3:49661737-49661759 AGGTGGCCACCCTTCCCGCGGGG - Exonic
955291095 3:57692982-57693004 AGCCGGGCCCCAAGCCCGCAGGG + Exonic
955406148 3:58627001-58627023 AAGTGGGCACCAGGCCTGGGTGG + Exonic
961870231 3:129982168-129982190 TGGTGGGCTCCAAGCACGCTGGG - Intergenic
967817358 3:193810728-193810750 AGGTGGGCAGCAAGCTCTGGTGG - Intergenic
968651478 4:1761871-1761893 AGGTGGGCAGGAGGCCCGCTGGG - Intergenic
969524358 4:7696661-7696683 AGGTGGGCACCAAACCAACTGGG - Intronic
985264713 4:188147002-188147024 AGGTGGGAAACAAGACCGAGTGG + Exonic
989182024 5:38587748-38587770 AGGTGGGAATCTAGCCCGCTGGG - Intronic
991971084 5:72142139-72142161 GGGTGGGCACCAAGCCCAGATGG - Intronic
997551441 5:134756894-134756916 AGGTGGGCAGCAAGCCACGGGGG + Intergenic
1001810139 5:174621376-174621398 AGGTGGGCAGAAAGCCAGCTGGG + Intergenic
1003573468 6:7271184-7271206 AGGCGGGCACCACGCCCACACGG + Intronic
1012063603 6:94517587-94517609 AGGTGGGCAGCAAGCCACCATGG + Intergenic
1013366372 6:109440979-109441001 AGGTGGGCACCAAGCCCGCGTGG - Exonic
1020213298 7:6171033-6171055 AGGCGGGCCCCCAGCACGCGGGG - Intronic
1030292621 7:107887859-107887881 GAGTGGGCACCAAGGCCGAGGGG - Intergenic
1032783980 7:135186252-135186274 AGGTGGCCACCGAGCCCCTGTGG - Exonic
1034468908 7:151245545-151245567 GGGCGGGCTCCATGCCCGCGGGG + Exonic
1035061103 7:156070312-156070334 AGGTGGGCACCAATCCAGCATGG - Intergenic
1035681991 8:1495091-1495113 GGGAGGGCACCAAGACCGCCAGG - Intergenic
1036033379 8:4994695-4994717 AGGAAGGCACCAAGGCGGCGAGG + Exonic
1043866796 8:85383777-85383799 AGGTGAGCAGCAGGCCAGCGAGG + Intronic
1049024344 8:139978600-139978622 AGGTGGGCGACAAGCACGTGGGG + Intronic
1049219338 8:141421725-141421747 AGGTGGGCCCCAAGCCCCCAAGG - Exonic
1053762403 9:41355863-41355885 AGGTGGGCAGAAAGCCCATGAGG - Intergenic
1056427450 9:86491332-86491354 TGGAGTGCACCAAGCCTGCGGGG + Intergenic
1060937465 9:127523975-127523997 AGGTGACCAGCAAGCCGGCGGGG + Intronic
1061257504 9:129460987-129461009 CCGTGGGCACCAGGCCCACGAGG - Intergenic
1062170012 9:135129516-135129538 TGGTGGGCACCAAGCCTCCGTGG + Intergenic
1187267849 X:17752275-17752297 AGCTGGGCACCAGGACCACGAGG + Intronic
1190743458 X:53306169-53306191 AGATGGGCCCCAAGCACTCGGGG - Intronic
1195687768 X:107601581-107601603 AGGTGAGCACCATGCCCTCTAGG + Exonic
1200966309 Y:9041950-9041972 AGGTGTGCGCCAAGGCCTCGTGG + Intergenic