ID: 1013366373

View in Genome Browser
Species Human (GRCh38)
Location 6:109440995-109441017
Sequence CGCAGGCGGCGCGCACAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366373_1013366381 -5 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366373_1013366380 -6 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366373_1013366383 2 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366373_1013366384 11 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366373_1013366382 -4 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366373 Original CRISPR CGCAGGCGGCGCGCACAGGT GGG (reversed) Exonic
913610142 1:120503022-120503044 GCCAGGGGGCGCTCACAGGTGGG - Intergenic
914581048 1:149019217-149019239 GCCAGGGGGCGCTCACAGGTGGG + Intronic
920021182 1:202957968-202957990 CGGAGGCGGCGCGCAGTGGGAGG + Intronic
921155017 1:212432800-212432822 CGCAGGAGGCGCGCGAAGGGCGG + Intergenic
922730740 1:227947758-227947780 GGCGGCCGGCGCGCACTGGTGGG - Intronic
922774393 1:228208136-228208158 CGCAGGCTGGGGGCACAGGCTGG - Exonic
922791842 1:228315183-228315205 CACAGGTGGCTCGGACAGGTGGG + Intronic
923429373 1:233905499-233905521 CGCAGGCGCCACGGGCAGGTGGG - Intronic
1067559943 10:47298315-47298337 CGCAGGAGGCCCGCACAAGCTGG - Intergenic
1069901081 10:71707068-71707090 CCCAGGAGGCCTGCACAGGTGGG - Intronic
1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG + Exonic
1077705966 11:4485905-4485927 AGCAGGCAGCCAGCACAGGTAGG - Intergenic
1084072348 11:66744682-66744704 CGCAGGCGCGGCGGGCAGGTGGG + Intronic
1084480356 11:69416250-69416272 GGCAGGCGGCGTGTGCAGGTTGG + Intergenic
1097166370 12:57088681-57088703 CGCCGGCGGGGCGCTCACGTGGG + Intergenic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1102518485 12:113465342-113465364 CGGAGGCGGCGCGCACGGCGCGG - Intronic
1104841751 12:131829015-131829037 CGCACGCAGCGCGCAGAGCTCGG - Intronic
1105044050 12:132986811-132986833 CGCAGGCAGCGCGCGAACGTGGG + Exonic
1110775663 13:79405851-79405873 CGCGGGCGGCGCGCGGAGGAGGG - Exonic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1122898712 14:104773233-104773255 CGCAGGTGGGGCGCACACCTCGG + Exonic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1125956072 15:43792151-43792173 CGCAGGCGGAGCGCTCAGCGTGG - Intronic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1137001748 16:35235251-35235273 CCCAGGTGGCCCTCACAGGTGGG + Intergenic
1139402773 16:66696066-66696088 CGAGGGCGGAGCGGACAGGTAGG + Intronic
1141946230 16:87311562-87311584 CCCTGGCGGAGCACACAGGTTGG + Intronic
1142509769 17:386094-386116 GGCCGGCGGGGCGCACAGGGAGG - Intronic
1146787302 17:35731650-35731672 AGCAGGCGGCGCGCTCCGGAGGG + Exonic
1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG + Intergenic
1151802044 17:76384504-76384526 CGGAGGCGGCGCGCTGAGGCCGG + Intronic
1156149445 18:34224605-34224627 CCCAGGCGCCGGGCACTGGTCGG - Intronic
1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG + Intronic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
937956171 2:127422851-127422873 CGGAGGGGGCGCGCCCGGGTGGG - Intronic
938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG + Exonic
946174354 2:217913391-217913413 TGCAGCCGGCTTGCACAGGTTGG + Intronic
946226936 2:218269244-218269266 CGCTGGAGGAGCCCACAGGTGGG - Intronic
946313834 2:218897141-218897163 CGCGGGCGGCGAGAAAAGGTGGG - Intronic
948484365 2:238271184-238271206 AGCTGGCGGCCCCCACAGGTGGG + Intronic
948560201 2:238847208-238847230 CGAAGGCGGAGCGCAGAGGCTGG + Intergenic
948897161 2:240932891-240932913 CGGTGGCGGCGGGAACAGGTGGG + Intronic
1171346435 20:24469567-24469589 CGCAGGCGGAGAGCGCAGGGCGG + Exonic
1176856673 21:13980214-13980236 CGGAGGCGGCACGCACTGGCAGG + Intergenic
1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG + Intronic
1184238105 22:43197085-43197107 CGCAGGGGGCGCCCACATTTAGG - Intergenic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG + Exonic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
987543792 5:19287765-19287787 CGCAAGCGCCGCGCGCAGGCCGG - Intergenic
990041501 5:51383085-51383107 CGCAGGCGGCGCGGCCGGGAAGG + Intergenic
990428587 5:55712492-55712514 GGCAGCCGGCGCGCCCAGGTGGG + Exonic
990978134 5:61576931-61576953 GGCAGGCGGGGAGTACAGGTGGG + Intergenic
998130324 5:139648507-139648529 AGCAGGCGGCGCGCATGGCTGGG - Exonic
1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG + Intergenic
1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG + Exonic
1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG + Intergenic
1004709389 6:18155491-18155513 CGCGCGCCGCGCGCACAGGACGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1017073768 6:150599972-150599994 CCCGGGCGGCGCTCGCAGGTCGG - Exonic
1017839543 6:158210127-158210149 CGCAAGCGCCGCGCACAGGCCGG + Intergenic
1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG + Intronic
1020007397 7:4789912-4789934 CGCTGCCGGTGTGCACAGGTAGG + Exonic
1024085498 7:45888844-45888866 CGCACGCGGCGCCCAGAGGCAGG - Exonic
1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG + Exonic
1035203959 7:157282564-157282586 CGCAGGTGGGGCTGACAGGTGGG - Intergenic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1039210253 8:35205059-35205081 GGCAGGGGGCGGGAACAGGTGGG - Intergenic
1039921683 8:41897538-41897560 CGCAGGCGGCGTCCCCAGGGAGG - Intergenic
1057858876 9:98624234-98624256 CACAGGCAGCGTGCACAGGAAGG + Intronic
1061028584 9:128066551-128066573 CCCAGGCGGCGTGCATAAGTGGG - Intronic
1187959859 X:24558169-24558191 GGCAGGGGGCGCGCAGAGTTGGG + Intronic