ID: 1013366374

View in Genome Browser
Species Human (GRCh38)
Location 6:109440996-109441018
Sequence TCGCAGGCGGCGCGCACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366374_1013366383 1 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366374_1013366382 -5 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1013366374_1013366380 -7 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366374_1013366381 -6 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366374_1013366384 10 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366374 Original CRISPR TCGCAGGCGGCGCGCACAGG TGG (reversed) Exonic
900287617 1:1909108-1909130 TCGCAGGCCGCGCGGACTCGGGG - Intergenic
901016709 1:6236021-6236043 TGGCAGGCGGCGCGCAGCTGCGG - Intergenic
901109540 1:6784654-6784676 TCACCGGGGGCGGGCACAGGAGG + Intergenic
915238404 1:154502257-154502279 TCGGAGGCGGCGGGCGCCGGGGG + Intronic
919928193 1:202203713-202203735 TAGCAGGCGGGGCACAGAGGAGG + Intronic
923016013 1:230127191-230127213 GCGCAGGCGGGGCTCACAGCAGG - Intronic
923429374 1:233905500-233905522 TCGCAGGCGCCACGGGCAGGTGG - Intronic
1066022879 10:31319961-31319983 CCGCCCGCGGCGCGCACAGCCGG - Intronic
1068538484 10:58267363-58267385 TGACAGGGGGCTCGCACAGGCGG + Intronic
1069664489 10:70145664-70145686 TCGCGGGCGGCGCGGAAAAGGGG + Exonic
1083898561 11:65632575-65632597 TCGCAGTGAGCGCTCACAGGCGG + Intronic
1095986486 12:48002910-48002932 TGGAAGGCGGCGGGCTCAGGCGG - Intronic
1097166369 12:57088680-57088702 TCGCCGGCGGGGCGCTCACGTGG + Intergenic
1102056519 12:109900475-109900497 CCGCAGGCGGCCCGCGCGGGCGG + Intronic
1108396554 13:49996697-49996719 TCCCAGGCGGCCCGCGCGGGTGG + Intronic
1110775664 13:79405852-79405874 ACGCGGGCGGCGCGCGGAGGAGG - Exonic
1122609177 14:102969588-102969610 TCGCACGCGGCTCACACATGAGG + Intronic
1202858247 14_GL000225v1_random:64462-64484 TGGCAGGGCGCCCGCACAGGAGG - Intergenic
1127753403 15:62067902-62067924 CCGTAGGCGGTGCGCACACGGGG - Exonic
1131525330 15:93147887-93147909 TCGCAGGCCTGGCACACAGGGGG - Intergenic
1132532709 16:461181-461203 TCGCATGCGGAGCACACAGTAGG + Intronic
1132983737 16:2752821-2752843 TCGGAGGCGGCGGGCGGAGGCGG + Exonic
1140025852 16:71289567-71289589 ACGGAAGCGGCGCGCGCAGGCGG + Exonic
1140686013 16:77434734-77434756 CGGCAGGCGGAGCGCACGGGCGG + Exonic
1142822799 17:2485179-2485201 TCGCATGCGGCGTTCCCAGGAGG - Intronic
1143445313 17:7005852-7005874 TCCCAGGCAGTGAGCACAGGTGG + Exonic
1143501770 17:7343466-7343488 TCCCAGGCGCCGGGCCCAGGAGG + Exonic
1146157262 17:30535054-30535076 TCCCAGGCAGTGAGCACAGGTGG + Intergenic
1146787301 17:35731649-35731671 GAGCAGGCGGCGCGCTCCGGAGG + Exonic
1160869274 19:1269592-1269614 TCGCCGGCGGCCCGGACCGGCGG - Intronic
1161366105 19:3880720-3880742 TCGGAGGCAGGGCGCGCAGGCGG + Exonic
1165872759 19:38984825-38984847 TGGCAGGCGGAGAGCACAGAGGG - Intergenic
1166568483 19:43779361-43779383 TGGCAGGCGGCGGGCACTGAGGG - Intronic
935149105 2:100417650-100417672 GGGCAGGCGGCGCGCACGGCCGG - Exonic
945169601 2:206981876-206981898 TAGCAGGCGCCGCACACAGAGGG + Intergenic
947188021 2:227472297-227472319 GCGCGGGCGGCGCGCGCAGACGG + Exonic
947766621 2:232641967-232641989 TCGCAGCTGGCGCTCACAGCTGG + Intronic
1179576478 21:42311321-42311343 AGGCAGGCAGCGCTCACAGGAGG + Intergenic
1179576483 21:42311347-42311369 AAGCAGGCAGCGCTCACAGGAGG + Intergenic
1179576489 21:42311373-42311395 AGGCAGGCAGCGCTCACAGGAGG + Intergenic
1183717131 22:39540105-39540127 TCGAAGGCTGAGCCCACAGGGGG - Intergenic
1184192079 22:42901648-42901670 TGGCAGGCGGAGAGCACAGCTGG - Intronic
1185188942 22:49420792-49420814 TTGGAGGTGGCGCTCACAGGTGG + Intronic
954004099 3:47578515-47578537 CCGCTGGCGGCGGGGACAGGTGG - Intronic
954663691 3:52239214-52239236 GCGCAGGCTGCGCGCACGCGCGG - Exonic
961665082 3:128489488-128489510 TAGCAGGCGGCTCGGGCAGGCGG - Intronic
967263603 3:187670255-187670277 GCGCAGCCAGCGCGCACTGGAGG + Exonic
981070003 4:140524425-140524447 TCGCGGGCGGCGCGCGAGGGGGG + Intronic
990428586 5:55712491-55712513 GGGCAGCCGGCGCGCCCAGGTGG + Exonic
990978133 5:61576930-61576952 TGGCAGGCGGGGAGTACAGGTGG + Intergenic
997402385 5:133612599-133612621 GGGCGGGCGGCGCGCACAGGTGG - Intergenic
1002046135 5:176542848-176542870 TCCCCGGCGGCCGGCACAGGGGG + Intronic
1003503980 6:6725031-6725053 TCGCAGACAGCGCGCTGAGGCGG + Intergenic
1003603664 6:7541477-7541499 TCGCGGGCGGCGGGCGCAGGTGG + Intergenic
1006333797 6:33410500-33410522 TCCCAGGTGCCGCGCGCAGGAGG + Intronic
1013366374 6:109440996-109441018 TCGCAGGCGGCGCGCACAGGTGG - Exonic
1014724980 6:124962665-124962687 GCGGAGGCGGCGCGCAGCGGGGG - Exonic
1019104048 6:169654716-169654738 GAGAAGGAGGCGCGCACAGGAGG + Intronic
1019900134 7:4013969-4013991 CCGCAGGCGGCGGGGACACGGGG - Intronic
1024983601 7:55177767-55177789 TGGCAGGCAGAGCGCACAGTTGG - Intronic
1029388605 7:100259789-100259811 TGGCAGTCAGCGCGCAGAGGAGG + Intronic
1038295933 8:26291308-26291330 GCGCAGGCGGTGCGGACAGAGGG + Intergenic
1038544045 8:28412087-28412109 CTGCAGGCGGCGCGCAGGGGTGG - Intronic
1039210254 8:35205060-35205082 TGGCAGGGGGCGGGAACAGGTGG - Intergenic
1051780558 9:20684344-20684366 CCGCAGGCGGCGCGACCCGGCGG - Intronic
1053352437 9:37422629-37422651 TCGCGCGCGGCGTGCGCAGGGGG - Intergenic
1058894297 9:109386521-109386543 ACACAGGCGGCTCACACAGGAGG + Intronic
1061844009 9:133376494-133376516 TCGCAGGCGCCCCACGCAGGGGG + Exonic
1186510437 X:10126061-10126083 GTGCAGGCGGCGCTCACAGATGG - Intronic
1189473657 X:41333319-41333341 GAGCCGGCGGCGCGCGCAGGTGG - Intergenic
1195370256 X:104166455-104166477 TCGCAAGCGGCGAGCGCAGTGGG + Intergenic
1200081827 X:153580827-153580849 TTGCAGGCGGCTCCCTCAGGTGG - Exonic