ID: 1013366375

View in Genome Browser
Species Human (GRCh38)
Location 6:109440999-109441021
Sequence TCTTCGCAGGCGGCGCGCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366375_1013366381 -9 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366381 6:109441013-109441035 CTGCGAAGAAGGAACGGTCTGGG 0: 1
1: 0
2: 0
3: 0
4: 62
1013366375_1013366383 -2 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366383 6:109441020-109441042 GAAGGAACGGTCTGGGGAGAAGG 0: 1
1: 0
2: 4
3: 49
4: 410
1013366375_1013366387 28 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366387 6:109441050-109441072 GGCCGCCCCCGTCCCCACCGCGG 0: 1
1: 0
2: 2
3: 50
4: 282
1013366375_1013366380 -10 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366375_1013366384 7 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366375_1013366382 -8 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366382 6:109441014-109441036 TGCGAAGAAGGAACGGTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366375 Original CRISPR TCTTCGCAGGCGGCGCGCAC AGG (reversed) Exonic
900244052 1:1629630-1629652 TCTTCGCAGAGTGCGCGCGCAGG + Exonic
900289926 1:1919489-1919511 TCGTCGCAGGCCTCGCCCACAGG + Intergenic
900996130 1:6124580-6124602 CCTTCGCAGACGGCGTGCCCCGG - Exonic
902350210 1:15848343-15848365 TCTTCGAAGGCGGCGCGGCTTGG - Intronic
920021179 1:202957964-202957986 GCCTCGGAGGCGGCGCGCAGTGG + Intronic
922821315 1:228487552-228487574 TGGCCGCAGTCGGCGCGCACCGG - Exonic
1065114970 10:22476362-22476384 GCTGCACAGGCGGCGCCCACAGG - Intergenic
1065637507 10:27745857-27745879 TGTTCCCGGGCGGCGCGCGCCGG - Exonic
1067055210 10:43045976-43045998 TCTTCCCAGGCGGTGCCCAGAGG - Intergenic
1073061383 10:100735750-100735772 TCCTCGCCTGCGGCGCGGACGGG - Intronic
1077298719 11:1837706-1837728 TCTTCCCAGGCGGCCCGGAGAGG - Intergenic
1082782968 11:57301365-57301387 TCTTAGCCGGCGGCAGGCACAGG - Intronic
1083849027 11:65354767-65354789 CCGGCGCGGGCGGCGCGCACGGG + Exonic
1102457159 12:113077919-113077941 CCTTCACAGGCGCCGCGCTCTGG + Exonic
1113407759 13:110057238-110057260 TCTTCCCAGGCTGGGCTCACAGG - Intergenic
1114503641 14:23191064-23191086 CCATCGCAGGCTGCGCGCAGTGG + Intronic
1123169378 14:106356759-106356781 TCTTCTCAGGCGTCCCACACTGG - Intergenic
1141814035 16:86397252-86397274 TCTTCCCAGGCCGTGCCCACCGG - Intergenic
1142319818 16:89373897-89373919 TCTTGGCAGGCGGTCCACACGGG + Intronic
1152197133 17:78924651-78924673 TTTTGGCAGGCGGCGCGCCCTGG - Intronic
1152861262 17:82698138-82698160 TCTCCGCAGTCTGCGCGCAGCGG - Intronic
1160515878 18:79478949-79478971 TCTGTGGAGGCGGCGCGCAGTGG - Intronic
1161165256 19:2783303-2783325 TTTGCGCAGGCGTCGCGCCCTGG - Exonic
1162046884 19:8005776-8005798 ACTTCGCAGGCGGCGCCGACCGG - Intronic
1168691624 19:58380941-58380963 TCTCTGGAGGCGGCCCGCACGGG + Exonic
926077306 2:9951662-9951684 TCCGCGCGGGCTGCGCGCACTGG - Intergenic
936713764 2:115161938-115161960 TCATCGCCGGCGGCCCGCGCTGG - Exonic
938018888 2:127889808-127889830 TCTTCTCAGGCTGGGCGCAGTGG - Intergenic
954368109 3:50156678-50156700 TCTAGGCAGGCGGGGGGCACAGG + Intronic
961067120 3:123884672-123884694 TCCTCGCAGGCGGCGGTCAGCGG + Intergenic
1013366375 6:109440999-109441021 TCTTCGCAGGCGGCGCGCACAGG - Exonic
1014724984 6:124962668-124962690 TCCGCGGAGGCGGCGCGCAGCGG - Exonic
1021558589 7:21946052-21946074 TCTTCGCAGGCGGCGCGAGAGGG + Exonic
1049533830 8:143168970-143168992 TCTTCCCAGGCAGGGCCCACAGG + Intergenic
1059305377 9:113349694-113349716 CCCGCGCAGGCGGCGCACACGGG - Exonic