ID: 1013366380

View in Genome Browser
Species Human (GRCh38)
Location 6:109441012-109441034
Sequence CCTGCGAAGAAGGAACGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366369_1013366380 20 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366372_1013366380 10 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366368_1013366380 21 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366373_1013366380 -6 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366371_1013366380 16 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366375_1013366380 -10 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366374_1013366380 -7 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366380 Original CRISPR CCTGCGAAGAAGGAACGGTC TGG Exonic
902542173 1:17163217-17163239 CCTGCGAAGGAGGAGTGGCCTGG - Intergenic
903216662 1:21847285-21847307 CCTGGGGAGAAGGAACTTTCAGG - Intronic
911052231 1:93681187-93681209 TCTGCGAAGAGGGGACGGGCGGG + Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1079402158 11:20114562-20114584 CAGGCAAAGAAGGAACAGTCTGG - Intronic
1080644218 11:34176385-34176407 CGTGCTTAGAAGGAACAGTCTGG - Intronic
1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG + Intronic
1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG + Intronic
1089058417 11:115606672-115606694 CCTGCGCAGAAGGTTCGGGCCGG + Intergenic
1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG + Intergenic
1100774862 12:97962810-97962832 GCTGTGAAGTAGGAACAGTCTGG - Intergenic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1107448738 13:40489967-40489989 CCTCCGAAGAAGGCAAGGTTTGG - Intergenic
1112012759 13:95305814-95305836 CCTGTGAAGAAGGAAGAGTGGGG - Intergenic
1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1125745836 15:41996632-41996654 CGTGGGAAGAAGGGGCGGTCTGG + Intronic
1129538007 15:76329948-76329970 CCTAGGAAGAGGGAACGGTCTGG - Intergenic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1142215627 16:88828474-88828496 CCTGCCCAGAGGGAACTGTCGGG + Intronic
1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG + Intronic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1163158841 19:15453096-15453118 CCTGTGAACAAGGTAAGGTCAGG - Exonic
1164611057 19:29631971-29631993 CCTGGGAAGATGGAACAGTAGGG + Intergenic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG + Exonic
926917765 2:17909387-17909409 CCTGGGAAGAACAAAGGGTCAGG - Intronic
928816881 2:35307565-35307587 CATGCGTAGAAGGAATGGCCTGG - Intergenic
932493075 2:72133744-72133766 CCTGCGATGGAGGAAGGGGCTGG - Intronic
936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG + Intronic
946084413 2:217156600-217156622 CCTATGAAGAAGGAAGGGACTGG - Intergenic
946158194 2:217820608-217820630 ACGGCGAAGAAGGGATGGTCAGG + Intronic
947793577 2:232880890-232880912 ACTGCGAAGGAGGAAAGGTGGGG + Intronic
947925161 2:233914836-233914858 CCTGCCAAGAAGGTAAGATCAGG + Intergenic
1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
950171182 3:10840026-10840048 CATGGGAGGAATGAACGGTCAGG - Intronic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
960996993 3:123346784-123346806 CCTGGGGAGAAGGAACTCTCCGG + Intronic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
981455468 4:144948206-144948228 CCTGAGAAGAAGGAGTGGCCTGG - Intergenic
984092118 4:175387474-175387496 CCTGTGAGGAAGGATGGGTCAGG - Intergenic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991913484 5:71584075-71584097 CCTGGGCAGAGGGAACGGTGCGG + Intergenic
995666192 5:114544925-114544947 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG + Intergenic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1003184353 6:3817933-3817955 CCTCCTAAGAGGGAAGGGTCAGG - Intergenic
1005150923 6:22749576-22749598 CATGTGAAGAAGGAACAGACTGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014089282 6:117385139-117385161 CCTGCCAAGAACCAACGCTCAGG + Intronic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1018931093 6:168240895-168240917 CCTGTGATCAAGGAAGGGTCAGG + Intergenic
1019803768 7:3107549-3107571 CCTGTGAAGAGGGAACAGTGTGG + Intergenic
1031103167 7:117507241-117507263 CCTGAGGAGAAGGCAAGGTCGGG - Intronic
1033658883 7:143390556-143390578 CCTGGGAAGAAGGAAGGGTGAGG - Exonic
1037070631 8:14643500-14643522 GATGCGAAGAAAGAAAGGTCAGG + Intronic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG + Exonic
1049956432 9:697244-697266 CCTGCCAAGAAGGCATGGCCTGG - Intronic
1050171493 9:2824106-2824128 CCTTGGAAGAAGGATCTGTCTGG - Intronic
1052546655 9:29889009-29889031 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
1059044960 9:110856363-110856385 CCTGTGAAGGAGTAACAGTCAGG - Intergenic
1193582857 X:83286494-83286516 CCTGGGAAGAACAAAGGGTCAGG + Intergenic