ID: 1013366380

View in Genome Browser
Species Human (GRCh38)
Location 6:109441012-109441034
Sequence CCTGCGAAGAAGGAACGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366373_1013366380 -6 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366371_1013366380 16 Left 1013366371 6:109440973-109440995 CCTGAGCCACGCGGGCTTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366372_1013366380 10 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366375_1013366380 -10 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366374_1013366380 -7 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366369_1013366380 20 Left 1013366369 6:109440969-109440991 CCGACCTGAGCCACGCGGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67
1013366368_1013366380 21 Left 1013366368 6:109440968-109440990 CCCGACCTGAGCCACGCGGGCTT 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366380 Original CRISPR CCTGCGAAGAAGGAACGGTC TGG Exonic