ID: 1013366384

View in Genome Browser
Species Human (GRCh38)
Location 6:109441029-109441051
Sequence GTCTGGGGAGAAGGCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013366373_1013366384 11 Left 1013366373 6:109440995-109441017 CCCACCTGTGCGCGCCGCCTGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366374_1013366384 10 Left 1013366374 6:109440996-109441018 CCACCTGTGCGCGCCGCCTGCGA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366375_1013366384 7 Left 1013366375 6:109440999-109441021 CCTGTGCGCGCCGCCTGCGAAGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366379_1013366384 -6 Left 1013366379 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366372_1013366384 27 Left 1013366372 6:109440979-109441001 CCACGCGGGCTTGGTGCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202
1013366378_1013366384 -3 Left 1013366378 6:109441009-109441031 CCGCCTGCGAAGAAGGAACGGTC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013366384 Original CRISPR GTCTGGGGAGAAGGCGCCGC CGG Exonic
900166728 1:1246943-1246965 GTCTGGGGAGGAGGAGGCGAGGG - Intergenic
900360030 1:2284012-2284034 GTCTGGGGAGAAGATGGCACGGG - Intronic
900659298 1:3774794-3774816 GTCTGGGGAGGATGCGTGGCTGG - Intronic
900687006 1:3954969-3954991 GTCTGGGGAGAACGTGCTCCAGG + Intergenic
900808114 1:4781208-4781230 GACTGGGGAGGAGGGGCCCCAGG - Intronic
901026221 1:6280036-6280058 GCGTGGGGAGCAGACGCCGCGGG + Intronic
901232688 1:7650016-7650038 GTGTGGGGAGGTAGCGCCGCAGG - Intronic
901453500 1:9350460-9350482 GAATGGAGAGCAGGCGCCGCCGG + Intronic
901468871 1:9441705-9441727 GTCGGTGGAGGAGGCGCCGGAGG - Intergenic
901648484 1:10729139-10729161 GCCTGGGGGGCAGGAGCCGCAGG - Intronic
901941545 1:12666076-12666098 GTCTGTGGAGAAAGCGTCGGAGG + Exonic
902622258 1:17657367-17657389 GGCTGGGGAGAAGGTGCGTCTGG - Intronic
903274314 1:22210974-22210996 GTGAGGGGAGAGGGCGCTGCTGG + Intergenic
903284270 1:22267386-22267408 TTCTGGGGAGAAGGTGTGGCCGG + Intergenic
903331437 1:22599082-22599104 GAGTGGGGAGATGGCGCCGGTGG + Intronic
903956774 1:27031533-27031555 GTCTGGGGAGAGGGCGGCTCTGG - Intergenic
905389334 1:37626206-37626228 GTCCGGGGAGAAGATGCTGCAGG - Intronic
906525392 1:46490500-46490522 GGCTGGGGAGGGGGCGCGGCCGG + Intergenic
907588786 1:55645921-55645943 GTCTGGGCAGAAGGCTGGGCTGG + Intergenic
912174707 1:107141294-107141316 GCCTGGGGAGGAGGCTCCGCGGG + Intronic
914346717 1:146806326-146806348 ATCTGGGGAGATGGTGCTGCAGG - Intergenic
915300417 1:154948281-154948303 GTCTGCGGAGACGGCGGGGCCGG - Exonic
915563553 1:156701383-156701405 GGCTGGGGAGAAGCTGCCCCTGG - Intronic
915564586 1:156706483-156706505 GCCGGGGGAGAAGGCGGAGCAGG + Intergenic
916828052 1:168462668-168462690 GTCTGGTGAGAAGGCGGCAGAGG - Intergenic
917031582 1:170698877-170698899 GTCTCTGGAGAAGGGGCCCCGGG + Intronic
917418096 1:174832617-174832639 GTCATGGGAGAAGGGGCTGCTGG - Intronic
919810980 1:201408686-201408708 GACTGGGCAGAAGGGGCCCCAGG + Exonic
922094855 1:222434656-222434678 GGCTGGGGAGAAGGAGCCCATGG - Intergenic
922502852 1:226109957-226109979 GTCGGGAGAGGAGGAGCCGCAGG + Intergenic
922766534 1:228159137-228159159 GGCTGAGGAGAAGGGGTCGCAGG - Exonic
922812492 1:228425344-228425366 GTCTGGGCAGAGGACACCGCGGG - Intergenic
922945211 1:229508221-229508243 GTCCGCGGAGAAGGGGCGGCTGG + Exonic
923354479 1:233140667-233140689 CTCTGGGGAGGAGGAGCAGCTGG + Intronic
1063197351 10:3756003-3756025 GGCTGGGAAGAAGGAGTCGCAGG + Intergenic
1063623365 10:7667639-7667661 GACTGGGGAGGAGGCGGGGCTGG - Intergenic
1067572976 10:47384829-47384851 GTCTGGGGAGCAGAGGCGGCGGG - Intergenic
1067669589 10:48306895-48306917 GGCTGAGGAGAAGGCGGCGGCGG - Intronic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1070858463 10:79628931-79628953 GTCTGGAGAGAGGGAGCAGCAGG + Intergenic
1072545159 10:96431772-96431794 GTCTGGGGACAGGGAGGCGCTGG + Intronic
1072680084 10:97499572-97499594 GCCGGGGGCGAGGGCGCCGCTGG + Intronic
1072795640 10:98352446-98352468 GTCTGCGGAGAAGACGCCTCAGG + Intergenic
1074854300 10:117462061-117462083 GTCTGGGGAGACAGCGAGGCTGG + Intergenic
1075594878 10:123721742-123721764 GGCTGGGGAGAAGACGCCCGAGG - Intronic
1076536114 10:131178732-131178754 GCCTGGGGAGAAGGTCCCGAGGG - Intronic
1076762995 10:132614951-132614973 GTCTGTGGCGTAGGCCCCGCAGG + Intronic
1076881943 10:133243867-133243889 GGCTGGGGAGACGCAGCCGCAGG + Intergenic
1077187025 11:1239981-1240003 GGCTGGGGAGCAGGCCCTGCAGG + Intronic
1077218786 11:1406096-1406118 GGCTGGGCAGGAGGAGCCGCTGG - Intronic
1077324202 11:1956707-1956729 GTCTGGGCAGTGGGCGCGGCCGG + Intronic
1077457569 11:2690067-2690089 GTCTGGGCTGAAGGCACAGCAGG + Intronic
1077537974 11:3133586-3133608 CTCTGGGGTGAAGGTGCTGCTGG - Intronic
1079238396 11:18705801-18705823 GTCTATGGTGAGGGCGCCGCGGG - Exonic
1081568536 11:44275551-44275573 GGCTGGGGTGAAGGGGCCCCAGG - Exonic
1083912337 11:65717518-65717540 GGCTGGGAAGAAGGGGCCTCAGG - Intronic
1084677124 11:70642016-70642038 GTCTGGAGAGAAGGCTACGGGGG + Intronic
1084695923 11:70755596-70755618 TTCTGGGGACAAGGCCCAGCAGG + Intronic
1202807188 11_KI270721v1_random:11902-11924 GTCTGGGCAGTGGGCGCGGCCGG + Intergenic
1091403776 12:196583-196605 CTCTGGGGTGAAGGGGCCACTGG - Intronic
1095450463 12:42325871-42325893 GTCTGGGGAGGGGGCCCCGCAGG + Intronic
1097173050 12:57128216-57128238 GCCAGGGGAGAGGGCGCCCCAGG + Intronic
1098166532 12:67704282-67704304 CTCTGGGGAGAAGGGGCAGCTGG - Intergenic
1102191523 12:110992203-110992225 GTCAGGGTAGAAGGGGCTGCTGG - Intergenic
1103897987 12:124286512-124286534 GTCTGGGGACCAGGCCCAGCCGG - Intronic
1104463011 12:128970307-128970329 CTCAGGGGAGAGGGCGCGGCGGG - Intronic
1105514238 13:21076129-21076151 GTGTGGGGAGCAGGGGCCGGAGG - Intergenic
1105943417 13:25170715-25170737 GCCCGGGGAGAGGACGCCGCGGG - Exonic
1106765692 13:32911526-32911548 GTCTGTGGATCAGGTGCCGCAGG + Intergenic
1107384538 13:39893839-39893861 GAATGGGGAGAAGGAGCAGCTGG + Intergenic
1108201747 13:48050921-48050943 GTCTGGGGAAAAGGTGGCACGGG - Intergenic
1116865052 14:50025130-50025152 GCCTGGGGAGAGGGCGCTCCTGG - Intergenic
1118743215 14:68756166-68756188 TACTAGGGAGAAGGCGCCCCAGG - Intergenic
1121368041 14:93332691-93332713 GGCTGGGGCCAAGCCGCCGCGGG - Intronic
1121420646 14:93811014-93811036 GTCTGGGGACAAGGGACAGCAGG + Intergenic
1121727956 14:96166664-96166686 GTCTGGGGAGAAGGTGGTGGAGG - Intergenic
1122153064 14:99734976-99734998 GGCTGGGGTGAGGGCGCGGCAGG - Intergenic
1202903391 14_GL000194v1_random:55653-55675 CTCTGGGGTGGAGGCGCTGCGGG + Intergenic
1126466037 15:48962614-48962636 TTCTGGGGAAGAGGGGCCGCTGG + Exonic
1126852487 15:52805719-52805741 CGCTGGCGAGAAGGCGCCGCTGG + Intergenic
1128392352 15:67190822-67190844 GTCTGGGGGGAGGGGGCCGGTGG - Exonic
1128943553 15:71807239-71807261 GTCTGGGCAGAAGGAGCAGGAGG + Intronic
1131259015 15:90878999-90879021 GGCTGGGGAGATGGGGCTGCTGG + Intronic
1132569276 16:637091-637113 GGCTGGGGAGAGGGCGGGGCTGG + Intronic
1132873200 16:2124634-2124656 GTCTGGGGAGTGGGCGCCTGGGG - Intronic
1136272189 16:29154917-29154939 GTGGGGGGAGTAGGGGCCGCAGG + Intergenic
1136417305 16:30112072-30112094 CTCTGGGGAGGAGGGGCCCCTGG + Intronic
1136592187 16:31224260-31224282 CTCGGAGCAGAAGGCGCCGCCGG + Exonic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1139480404 16:67227364-67227386 GGCTGGGGGGATGGCGGCGCAGG + Intronic
1139954912 16:70688459-70688481 GTCTGGGGAGAAGGGGGAGGTGG + Intronic
1139987264 16:70908944-70908966 ATCTGGGGAGATGGTGCTGCAGG + Intronic
1142025802 16:87812860-87812882 GTCTTGGGAGCAGCCGCTGCAGG - Intergenic
1142075766 16:88116821-88116843 GTCGGGGGAGTAGGGGCCGCAGG + Intronic
1142310142 16:89307531-89307553 CTCTGGGGAGACGGGGCCTCAGG + Intronic
1143375818 17:6466447-6466469 GTCAGGGGAGAGGGAGCAGCTGG + Intronic
1144057967 17:11558609-11558631 GGATGGGGAGAAGGAGGCGCGGG - Exonic
1145370483 17:22302956-22302978 GGCAGGGGAGAAGGGGCTGCGGG - Intergenic
1146470988 17:33124694-33124716 GACTGGGGAGAAGGGGGCGATGG + Intronic
1146845224 17:36178183-36178205 GCCTAAGGAGAAGGCGCCTCAGG + Intronic
1146873438 17:36390026-36390048 GCCTAAGGAGAAGGCGCCTCAGG + Intronic
1146880799 17:36441114-36441136 GCCTAAGGAGAAGGCGCCTCAGG + Intergenic
1147065950 17:37922847-37922869 GCCTAAGGAGAAGGCGCCTCAGG - Intergenic
1148203555 17:45765706-45765728 GGCTGGGGCGAAGGCTCTGCAGG - Intergenic
1148690862 17:49526091-49526113 GTCTGTGGAGAGGGCCCCACAGG - Intergenic
1148945597 17:51259894-51259916 GCCCGGGGAGGGGGCGCCGCGGG - Exonic
1152033228 17:77856531-77856553 CTCTGGGGAGGAGGGGCAGCTGG - Intergenic
1152687384 17:81701257-81701279 GTCTGCTGAGAAGGGGCCTCGGG - Intronic
1156499739 18:37550126-37550148 GTCTGGGGAGGGGGCTCAGCAGG + Intronic
1157576780 18:48748982-48749004 GGCTGGGGAGAAGGGGCCAGTGG - Intronic
1157794087 18:50559593-50559615 GGGTGGGGAGAAGGAGCCGGCGG - Intergenic
1160450746 18:78964906-78964928 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450784 18:78965029-78965051 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450803 18:78965090-78965112 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450821 18:78965151-78965173 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1161813048 19:6481714-6481736 CCCTGGGGAGAGGGCCCCGCTGG - Exonic
1162687735 19:12401206-12401228 GTGGGTGGAGAAGACGCCGCGGG + Exonic
1163712267 19:18853877-18853899 GTCCTGGGAGAAGACACCGCGGG + Intronic
1164838320 19:31373272-31373294 GACTGGGGAGAAGGCCCTTCTGG + Intergenic
1165091887 19:33392057-33392079 TTCTGGGGAGAAGGTGCGGCTGG + Intronic
1165309655 19:35022537-35022559 GCCTGGGAGGAAGCCGCCGCTGG - Intronic
1165434184 19:35787651-35787673 GGCTGGGGAGAAGAAGCCGGGGG - Exonic
1165745420 19:38227813-38227835 CCCTGGGGAGAAGGAGCTGCAGG - Intronic
1167289347 19:48615839-48615861 GTCTGGGGAGAGGGCAGGGCTGG + Intronic
1167358906 19:49019622-49019644 GTCTGGGTGGAAGCCGGCGCCGG - Intergenic
1167366599 19:49057870-49057892 GTCTGGGTGGAAGCCGGCGCTGG - Exonic
1168106407 19:54168293-54168315 CTGTGGGGGGAAGGCGGCGCAGG + Intronic
928165422 2:28968139-28968161 GTCTGGGGACAAGGACCCTCAGG + Intronic
928421369 2:31139569-31139591 GTCTGGGGAGCAGAGGCAGCGGG + Intronic
931304673 2:61017148-61017170 GTCTGGGGAGAAGGTGAGGCGGG - Intronic
932300479 2:70663521-70663543 CTCTGGGGACATGGGGCCGCTGG + Exonic
932773899 2:74515781-74515803 CTCTGCGGAGAGGGCGGCGCTGG + Exonic
939095123 2:137825499-137825521 GTCATGGGAGAAGGAGCCACAGG + Intergenic
944547578 2:200812494-200812516 GTCAGTGGAGAAAGAGCCGCGGG + Intronic
946170188 2:217890671-217890693 GTCTGGGGATAAGAAGGCGCTGG - Intronic
948746172 2:240095729-240095751 GTCTGGGGTGCAGGGGCCACGGG + Intergenic
948989918 2:241548503-241548525 GTCTGGGGAGAAGGTGGAGGAGG + Intergenic
1169198641 20:3697014-3697036 GTCTGGGGAGAAGCAGGGGCCGG - Intronic
1172101255 20:32484720-32484742 GTCCGTGGAGACGGCACCGCCGG + Intronic
1174069151 20:47887832-47887854 CTCTGGGGAGGAGGCGCAGCTGG + Intergenic
1175337290 20:58204944-58204966 GTCAGGGGAGATGGAGCCGAGGG - Intergenic
1175362153 20:58421025-58421047 ATCTGGGGAGAAGGGGAGGCTGG - Intronic
1175883584 20:62274707-62274729 GCCTGGGGAGAAGGAGCTGGAGG + Intronic
1175922283 20:62455837-62455859 GTCTGGGGAGGAGCCCCCACAGG - Intergenic
1176381910 21:6117918-6117940 GTGTGCGGAGAAGGCGGGGCAGG - Exonic
1176622756 21:9070421-9070443 CTCTGGGGTGGAGGCGCTGCGGG + Intergenic
1177780569 21:25618452-25618474 GCCTGGGGAGAAGACACAGCTGG + Intergenic
1179741562 21:43420321-43420343 GTGTGCGGAGAAGGCGGGGCAGG + Exonic
1180183431 21:46128095-46128117 GTCTGGGGAGGAGCCACCACAGG - Intronic
1180705764 22:17808853-17808875 GGCTGTGGAGAAGGCGCTCCGGG - Exonic
1182497364 22:30719107-30719129 GGCTGGAGAGAAGGCACAGCGGG - Intronic
1182511624 22:30824245-30824267 GCCTGGGGAGGAGGCGGCTCAGG + Intronic
1183060873 22:35335663-35335685 CTCTGGGGAGCAGGCTCCGGGGG + Intronic
1184481869 22:44752714-44752736 GTACGGGGACAAGGGGCCGCTGG + Intronic
1185347286 22:50316138-50316160 GGCTGGGGAGTAGGCTCTGCAGG - Intronic
949105458 3:197003-197025 CTCGGGGGAGAAGGCGCCCGAGG + Exonic
953152490 3:40337621-40337643 GTCTGGGTAGGAGGAGCCTCTGG - Intergenic
953992771 3:47496969-47496991 GCCTGAGGAGAAGGTGCTGCTGG - Intronic
954708963 3:52495582-52495604 GCCTGGGGAGAAACCGCAGCTGG + Intronic
955182214 3:56683056-56683078 GTGTGGGGGGAAGGGGCGGCGGG + Intronic
955410916 3:58654753-58654775 GGCTGGGGAGAAGGCCCGCCGGG + Intronic
961366218 3:126401665-126401687 GTCTCGGGAGAGGGAGCAGCAGG + Intronic
967574594 3:191076163-191076185 GAATGGGGAGAAGGCCCAGCTGG + Intergenic
968008888 3:195260313-195260335 GTCTGGAGAGGAGGGGCCGCGGG - Intronic
968353343 3:198080774-198080796 GGCTCGGGCGCAGGCGCCGCTGG + Intergenic
968545189 4:1194629-1194651 GGCTGGGGAGCAGGTCCCGCGGG - Intronic
969378125 4:6776556-6776578 GTCTGAGGGGAAGGAGCCTCAGG + Intergenic
970184148 4:13431359-13431381 GTCTTGGGAGAAGGGGCAGCGGG - Intronic
970195488 4:13547223-13547245 GTGTGTGGCGAAGGCGCAGCAGG + Intergenic
974009335 4:56592813-56592835 GTCTGGGCAGAAGGCGCTCCAGG - Intronic
981006322 4:139879019-139879041 GACTGGGGAGAAGGGACCACTGG + Intronic
983925982 4:173402751-173402773 GTATGGGGAGAAGCAGCAGCTGG + Intronic
985670325 5:1203521-1203543 GTCTGGGGAGAAGGGCCTGCTGG - Intronic
985958517 5:3282244-3282266 GTCTGGGAGGAAGGGGCAGCTGG + Intergenic
989197205 5:38727160-38727182 GACTGGGGAGAAGGGGCCTGGGG + Intergenic
989523254 5:42424722-42424744 GTCTAGGGAGAGGGCGCTGGCGG + Intronic
992052706 5:72955987-72956009 CTCTGGGAAGAAGGCGGCGGCGG + Exonic
992526790 5:77619526-77619548 GTCTGGGGAGAAGCAGCAGCTGG - Intronic
995106411 5:108381595-108381617 GCCTGAGGAGAGGGCGCCGGCGG + Exonic
1001315257 5:170637249-170637271 GTCTGAGGAGAAGGGGGAGCAGG - Intronic
1002060338 5:176621862-176621884 GTCTGGGCAGCAGACGCAGCGGG - Intronic
1002070995 5:176678899-176678921 GTCAGAGGAGAAGGCACCCCAGG - Intergenic
1002541128 5:179907413-179907435 ATCCGGGCAGAAGCCGCCGCCGG + Intronic
1004341592 6:14812762-14812784 GTATGGGGAGAAAGGGCTGCTGG - Intergenic
1004924419 6:20403558-20403580 GACTGGGGAGGAGGCGGCGGCGG + Intronic
1006183661 6:32168532-32168554 GTCTGGTGAGATGGTGCAGCAGG + Exonic
1006369492 6:33635021-33635043 GACTGGGGTGATGGAGCCGCAGG - Intronic
1006860498 6:37169398-37169420 GTCGGGGGCGAAGGATCCGCAGG - Intergenic
1013366384 6:109441029-109441051 GTCTGGGGAGAAGGCGCCGCCGG + Exonic
1016820630 6:148343010-148343032 GTGCGGGGCGAGGGCGCCGCGGG + Exonic
1016936167 6:149450879-149450901 GCCTGGGGCGACGGCGCCACTGG - Exonic
1018655135 6:166027066-166027088 CTCTGGGGAGTAGGCGCTGTGGG - Intergenic
1019395419 7:815797-815819 GCCTGGGGAGGAGGGGCCGCGGG + Intergenic
1019486850 7:1293334-1293356 GTCCGGGGAGCTGGCCCCGCTGG + Intergenic
1023902178 7:44490366-44490388 GTCTGGGGAGCCGCCGCCCCCGG - Intronic
1028796513 7:94908643-94908665 GGCGGGGGAGATGGGGCCGCCGG - Intronic
1035049538 7:155990548-155990570 AGCTGGGGAGAAGCCGCCCCTGG + Intergenic
1035664837 8:1373286-1373308 GTGTCGGGAGCAGGGGCCGCGGG + Intergenic
1035689620 8:1551461-1551483 ACCTGTGGAGAAGGCGCAGCTGG - Intronic
1037991474 8:23324314-23324336 ATCTGGGGACAAGGCTCCGGGGG + Intronic
1040033089 8:42843499-42843521 GTGGGGGGAGGAGGCGCGGCGGG + Intergenic
1044927910 8:97224734-97224756 TTCTGGGGAGAAGGTGCAGTGGG - Intergenic
1049556635 8:143285623-143285645 ATCTGGGGAGAGGGCTCCACGGG + Intergenic
1050537748 9:6645322-6645344 GTCTGGGCAGAAGGCGCTCCAGG + Exonic
1051079648 9:13279445-13279467 GACTGGGGAGCAGGGGTCGCCGG + Exonic
1052754418 9:32526028-32526050 TTCCGCCGAGAAGGCGCCGCTGG + Intronic
1056843457 9:90017666-90017688 GTCTGGGGAGAAGGCATGGATGG + Intergenic
1057025955 9:91733877-91733899 GTCTGGGGAGAAGGCTGTCCCGG + Intronic
1060114475 9:120929220-120929242 GTCTGGGGAGCAGCAGCCCCGGG - Intergenic
1061840653 9:133356796-133356818 GGCAGGGGAGAGGGCGCGGCGGG + Intronic
1062092769 9:134687170-134687192 GTCTGGGGATATGGCCCTGCTGG + Intronic
1062166324 9:135109436-135109458 GTGTGGGGAGAAGAAGCCGCAGG + Intronic
1062254937 9:135616425-135616447 GTCTGGGGAGCTGACGCCCCGGG + Intergenic
1062444078 9:136586053-136586075 GTGTGGGGAGCAGGCTCGGCAGG + Intergenic
1062476013 9:136727950-136727972 GGCCGCGGAGGAGGCGCCGCTGG - Intergenic
1062549753 9:137080551-137080573 GTCTAGGGAGGAGCCCCCGCAGG - Intronic
1203792705 EBV:160200-160222 GGCTGAGGAGAAGGCGAGGCCGG - Intergenic
1203745946 Un_GL000218v1:40849-40871 CTCTGGGGTGGAGGCGCTGCGGG + Intergenic
1190757277 X:53412063-53412085 GTCAGTGGAGAAGGCTCGGCAGG - Exonic
1194403017 X:93461533-93461555 GCCTGGGGAGAAGGAGACGCTGG + Intergenic
1194733715 X:97486918-97486940 GTCTGGGGAGAAGGAGGAGTGGG - Intronic
1200742355 Y:6868096-6868118 GTATGGGGGGCAGGGGCCGCAGG + Exonic
1201159270 Y:11155861-11155883 CTCTGGGGTGGAGGCGCTGCGGG + Intergenic