ID: 1013370945

View in Genome Browser
Species Human (GRCh38)
Location 6:109470519-109470541
Sequence GTCATGCCCCATGTTATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013370945_1013370947 16 Left 1013370945 6:109470519-109470541 CCCAGAATAACATGGGGCATGAC No data
Right 1013370947 6:109470558-109470580 CACCCAGCCCCTGTCCAGCCAGG 0: 1
1: 0
2: 1
3: 52
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013370945 Original CRISPR GTCATGCCCCATGTTATTCT GGG (reversed) Intronic