ID: 1013370945

View in Genome Browser
Species Human (GRCh38)
Location 6:109470519-109470541
Sequence GTCATGCCCCATGTTATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013370945_1013370947 16 Left 1013370945 6:109470519-109470541 CCCAGAATAACATGGGGCATGAC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1013370947 6:109470558-109470580 CACCCAGCCCCTGTCCAGCCAGG 0: 1
1: 0
2: 1
3: 52
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013370945 Original CRISPR GTCATGCCCCATGTTATTCT GGG (reversed) Intronic
900639721 1:3682839-3682861 GTCATGGGCTCTGTTATTCTGGG - Intronic
900927259 1:5713399-5713421 GTCACACCCCATGTGACTCTGGG - Intergenic
901958937 1:12809546-12809568 GTCGTGCCACCTGGTATTCTGGG - Intergenic
902078142 1:13803550-13803572 GTCATACTCCAGGTTGTTCTTGG - Intronic
902114059 1:14106664-14106686 GTGATGATCCCTGTTATTCTTGG + Intergenic
902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG + Intronic
904856062 1:33499085-33499107 GTCCTGCCTCATCTTGTTCTGGG + Intergenic
906196670 1:43934232-43934254 GTCCTGCACCTTGTTCTTCTAGG - Exonic
906516936 1:46445116-46445138 TTCATCACCCATGCTATTCTGGG - Intergenic
908105189 1:60834138-60834160 GTCAGGCACCATCTTAATCTTGG + Intergenic
912651095 1:111440411-111440433 GTCAGGCCCCATGCTGTTTTGGG + Exonic
912849922 1:113114721-113114743 TTCATGCCCAATGCTACTCTGGG - Exonic
915544270 1:156587098-156587120 CTCATGCCCCACCCTATTCTAGG + Intergenic
915544290 1:156587188-156587210 CTCATGCCCCACCCTATTCTAGG + Intergenic
915544296 1:156587218-156587240 CTCATGCCCCACCCTATTCTAGG + Intergenic
916569488 1:166012847-166012869 GTCTTGCCACATGTTTTCCTGGG + Intergenic
917042217 1:170818007-170818029 GTCTTGCACCATTTTATTTTGGG + Intergenic
917101157 1:171446766-171446788 ATCATGTCCCATGTTTTTCCAGG - Intergenic
919844287 1:201631385-201631407 GTCATGCCCCAAGTGACTTTGGG - Intronic
920874692 1:209823149-209823171 TTCATGCCCAGTGTCATTCTTGG + Intergenic
924938028 1:248788864-248788886 GTCATGCCACATACTGTTCTAGG - Intergenic
1069368965 10:67723817-67723839 GTCATACCCCACGTCTTTCTCGG + Intergenic
1074918600 10:117983455-117983477 GGCATGCCCCATGTAATTTTTGG - Intergenic
1075448926 10:122533929-122533951 GCCAGGCCCAATGTTGTTCTTGG + Intergenic
1076980761 11:203525-203547 TTCATCCCCCATGTTTTCCTGGG - Exonic
1080787331 11:35487430-35487452 GTCATGTCTCAGCTTATTCTTGG + Intronic
1085201530 11:74705113-74705135 TTCACGCCCCATGGGATTCTGGG - Intronic
1088156147 11:106805987-106806009 ATAATGCCACATGTTATTCAAGG + Intronic
1089093997 11:115902981-115903003 GTCAGTCCCCACTTTATTCTTGG - Intergenic
1091352755 11:134910596-134910618 GTCATGTCCCAGTTTATTCCAGG - Intergenic
1093165065 12:15795009-15795031 TTCATGTCCTATGTTAATCTGGG - Intronic
1103050635 12:117776467-117776489 GTCTGGCCCCATGTGAGTCTGGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1109575998 13:64259583-64259605 TTCATTCCCCAGGTAATTCTAGG - Intergenic
1128247349 15:66142149-66142171 GCAATGCCCCATCCTATTCTGGG + Intronic
1130327453 15:82892286-82892308 ATCTTGCCCCATAATATTCTAGG + Intronic
1132150705 15:99456109-99456131 GTCATGCCCCATATTTTGCTTGG + Intergenic
1136871013 16:33808329-33808351 CGCATCACCCATGTTATTCTCGG - Intergenic
1137895227 16:52205019-52205041 TTCAGGCACCATGTTATTGTAGG - Intergenic
1203101159 16_KI270728v1_random:1307729-1307751 CGCATCACCCATGTTATTCTCGG + Intergenic
1143393706 17:6575768-6575790 GTCATTCCCCATGACACTCTGGG - Intergenic
1146591216 17:34129507-34129529 GCCATGTCCCATGTTATACCTGG + Intronic
1151057460 17:71049710-71049732 ATCATGTCCCATGTTTGTCTTGG + Intergenic
1152099758 17:78294215-78294237 GTCCTGACCCCTGGTATTCTGGG + Intergenic
1154020861 18:10663025-10663047 GTCCTGCCTCATGTTCTTCCTGG - Intergenic
1155086597 18:22464898-22464920 GTCTTGCCTCATGTGATTCCGGG + Intergenic
1155841813 18:30654872-30654894 GTAATGCCCTACTTTATTCTGGG - Intergenic
1165941277 19:39415822-39415844 TTCAGGCCCCATATGATTCTTGG - Intronic
1166678842 19:44755423-44755445 GTCACGCCCCATGTGAATCAAGG - Intronic
926171598 2:10556175-10556197 CTCATGCCCCATGTTAATAATGG - Intergenic
930888340 2:56354097-56354119 GTCATGCCTCCTTTTATTGTAGG - Intronic
936274697 2:111084388-111084410 GTCAAGCCTCATGTTATGCTGGG - Intronic
944324033 2:198382550-198382572 CTCCTGCTCCATGTTATTCTAGG - Intronic
1169015094 20:2285465-2285487 GTGAAGGCCCATGTTATGCTGGG + Intergenic
1178559609 21:33626322-33626344 ATCATGCCCCATGGGATTCTGGG + Intronic
1182702409 22:32251205-32251227 GTCATATCCCAGGTTTTTCTGGG - Intronic
1184241696 22:43214395-43214417 GTCTTGCCCCAGGCTCTTCTGGG - Intronic
949577820 3:5355795-5355817 GTTATGCCAGATGTTATACTGGG - Intergenic
962109604 3:132430423-132430445 GTCATGCCCCGTGTTTTTTATGG + Intronic
962568536 3:136688958-136688980 ATCATCCCCCATCTTATTCCTGG - Intronic
963353800 3:144185123-144185145 GACATGGCCTATGTGATTCTGGG - Intergenic
969869894 4:10098086-10098108 GGCTTGCCCCATCTTGTTCTTGG - Intronic
972480981 4:39495830-39495852 TTACTTCCCCATGTTATTCTAGG - Intergenic
977291496 4:95169711-95169733 GTCATGCCACATGTTATGTTTGG + Intronic
983455308 4:167955517-167955539 GTCATGCCACCTCTTATTCAGGG - Intergenic
984895310 4:184533879-184533901 GTCATACCCAATTTTATCCTGGG + Intergenic
997368046 5:133338431-133338453 CTCCTGCCCCATGCTTTTCTAGG + Intronic
1003654199 6:7990538-7990560 CTAGTACCCCATGTTATTCTTGG + Intronic
1004260988 6:14107645-14107667 TACATGCCCAATGCTATTCTTGG + Intergenic
1004947274 6:20629773-20629795 GAGATGCCCCATGTTCTTCTTGG + Intronic
1013043862 6:106463979-106464001 GTTTTTCCCCATGTTTTTCTGGG - Intergenic
1013342068 6:109224625-109224647 GTCCTGTCCTATGTAATTCTGGG + Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1013947639 6:115741082-115741104 ATCATGCTGCAGGTTATTCTTGG - Intergenic
1015976293 6:138794761-138794783 GTCATGTGACATGTTTTTCTTGG + Intergenic
1018174773 6:161168975-161168997 GCTATGCCCCATGTCATGCTAGG - Intronic
1023373370 7:39533308-39533330 CTCAGGGCCCATGTTATTCCTGG - Intergenic
1032915563 7:136485304-136485326 ATCATTCACCATGTTATTATAGG + Intergenic
1037892323 8:22629848-22629870 GTCAGGCCCCATGGGAATCTGGG + Intronic
1046785359 8:118259999-118260021 CACATGCCAAATGTTATTCTAGG + Intronic
1049655850 8:143796939-143796961 GTCATTCCCAAGGTTATTCTTGG - Intronic
1053491765 9:38511805-38511827 CTTATGCCCCATTTTATTCCAGG - Intergenic
1054952959 9:70873523-70873545 CTCATGAACCATGTTGTTCTAGG + Intronic
1057290508 9:93803128-93803150 GCCCTGCCCCATGTGATGCTGGG + Intergenic
1057819112 9:98317717-98317739 GTCATGCACCATGTTGGTGTGGG + Intronic
1058594301 9:106598984-106599006 GCCATTGCCCATGTTCTTCTTGG - Intergenic
1058848989 9:108991879-108991901 GTCATGCTCCATGATCATCTGGG - Intronic
1059492433 9:114680047-114680069 GTCATGCCCCATGATTTCCCTGG - Intergenic
1199530759 X:148845012-148845034 GCCCTCCCCCTTGTTATTCTAGG + Intronic