ID: 1013374010

View in Genome Browser
Species Human (GRCh38)
Location 6:109496598-109496620
Sequence AAGGAGAGCCAGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 741}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013374010_1013374014 -9 Left 1013374010 6:109496598-109496620 CCCTCCTCATCCTGGCTCTCCTT 0: 1
1: 0
2: 7
3: 77
4: 741
Right 1013374014 6:109496612-109496634 GCTCTCCTTTCATGTCTCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013374010 Original CRISPR AAGGAGAGCCAGGATGAGGA GGG (reversed) Intronic
900562532 1:3314433-3314455 GAGGAAGGCCACGATGAGGATGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901212399 1:7534050-7534072 CAGGAGAGCCAGGCTGGGCAAGG - Intronic
901461348 1:9393626-9393648 AGGCAGAGCCAGGATCCGGAGGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901795119 1:11675430-11675452 CAGAAGAGCCAGGATGAGCTGGG + Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
902456814 1:16539333-16539355 AATGAGAGTCAGGAAGATGAGGG + Intergenic
902495355 1:16868580-16868602 AATGAGAGTCAGGAAGATGAGGG - Intronic
902666764 1:17944904-17944926 AAAGACAGCCAGGTAGAGGAAGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903407458 1:23110147-23110169 AATGAGAGCCAGCATGGTGAAGG - Intronic
903811786 1:26038769-26038791 AAGGCCAGCCAGGCTGAGAATGG + Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904612475 1:31733035-31733057 AAAGAGGGCCTGGAAGAGGACGG + Exonic
905234763 1:36538330-36538352 AAGGAAGGACAGGATGGGGATGG + Intergenic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905388509 1:37621217-37621239 AAGCAGGGGCTGGATGAGGAAGG + Intronic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905803146 1:40858706-40858728 TAGGAGAGCCAAGATGCGGGAGG + Intergenic
905875229 1:41427908-41427930 AAGGAGTGAGAGGAGGAGGACGG - Intergenic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906536086 1:46551682-46551704 AATGAGAGGCAGGGTGAGGGGGG + Intergenic
906724128 1:48031215-48031237 AAGCAGAGTGATGATGAGGAGGG - Intergenic
906859304 1:49341877-49341899 AAGGAGAGAGAGGAGGAGAAAGG - Intronic
906945301 1:50289828-50289850 CAGGAGGGCCAGGATCAGGGAGG - Intergenic
907289999 1:53407505-53407527 AAGGCTAGAGAGGATGAGGATGG + Intergenic
907425364 1:54375946-54375968 GAGGAGAGCAGGGAAGAGGAAGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908580671 1:65512637-65512659 AAAAACAGACAGGATGAGGAGGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
908982822 1:69979026-69979048 AAGGAGAGCCTGTCTAAGGATGG - Intronic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910496953 1:87840624-87840646 AAAGACATCCAGGCTGAGGATGG - Intergenic
910840550 1:91556995-91557017 AATGAGAGCCAGGATGTGTGTGG + Intergenic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912168540 1:107069437-107069459 GAGGAGTGGGAGGATGAGGAGGG + Intergenic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
912703417 1:111895100-111895122 AAGGAGGGGAAGGAAGAGGAAGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
915549448 1:156624015-156624037 AGGGCGCGCCAGGATGCGGAGGG + Exonic
915569336 1:156735826-156735848 CAGTAGAGCCAGGCTGAAGAAGG - Exonic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916823962 1:168426754-168426776 GAGGAGGGCCAGGATGCGGATGG + Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917191862 1:172426517-172426539 AATGAGAGGCAGGGTGAGGGTGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920997938 1:211013233-211013255 AAGGAAAGCCTGGAAGAGCAGGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921890161 1:220345816-220345838 CAGGAGGGGCAGGATCAGGAAGG - Intergenic
921948331 1:220904372-220904394 AAGGAAAGCCAGTATGCAGATGG + Intergenic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
922742250 1:228020540-228020562 AGGAAGAGAGAGGATGAGGAAGG + Intronic
922825833 1:228517827-228517849 AAAGATAGCCAAGATGAGGATGG - Intergenic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
923850023 1:237784379-237784401 AAGGAGAGGCCGGAAGAGCAGGG + Exonic
924150437 1:241124101-241124123 AAGAAGAACCAGGATGGGCATGG + Intronic
924611740 1:245579345-245579367 AAGGAGAGCCAGGTGCAGTAGGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063965586 10:11343797-11343819 ACGGAGAGCCTGGAAGAGGGAGG + Intergenic
1064327497 10:14364601-14364623 AAGAGGGGCCAAGATGAGGAGGG + Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1067307978 10:45083393-45083415 AAGGAGAGAGGGGATGAGGGAGG - Intergenic
1067343132 10:45419928-45419950 AAAGAGAGGCCGGAAGAGGAGGG + Intronic
1067438111 10:46292908-46292930 AAGGAGGGTCAGGGAGAGGAAGG + Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068610970 10:59059697-59059719 AAAGAGAGTCAGGAAAAGGAAGG + Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069534387 10:69242135-69242157 TGGGAAAGCCAGGCTGAGGAGGG - Intronic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070330101 10:75410266-75410288 AAGGAAAGAAGGGATGAGGATGG - Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071575244 10:86720824-86720846 AAGAAGATCCAGGAAGAAGACGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072402817 10:95122611-95122633 ATGGAGAGCCAGGAAAAGCAGGG - Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1073105515 10:101030391-101030413 AGGGAGAGCAGGGATGAGGGAGG + Intronic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1073287339 10:102396821-102396843 AAGGTGAGCCAGGATGGTGCTGG + Exonic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1074887239 10:117703827-117703849 AGGAAGAGCTGGGATGAGGATGG - Intergenic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075184694 10:120245225-120245247 AATGAAGGCCAGGCTGAGGAGGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075482720 10:122796316-122796338 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075482725 10:122796339-122796361 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075482730 10:122796362-122796384 AAGGAGAGAGAGGGAGAGGAAGG + Intergenic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076495178 10:130892605-130892627 GAGGAGAGGGAGGAAGAGGAGGG - Intergenic
1076600554 10:131654522-131654544 AAGCAGGGCCAGGAAGAGGCAGG - Intergenic
1076911261 10:133391284-133391306 AAGAAGAGCCAGGGTTAGAATGG - Intronic
1076988722 11:257872-257894 AAGATGAGCCAGGATGAGCCAGG - Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077910795 11:6570139-6570161 CAGGAGAGCCTGGAAGAGGGTGG + Intronic
1078102828 11:8339814-8339836 AAGGAGACCCGGGAAGAGGTTGG - Intergenic
1078461988 11:11521144-11521166 AAAGAGAGCCAGGAGGTGGTGGG - Intronic
1078626360 11:12962404-12962426 AAGGAGAGCTGGGATGATGTGGG + Intergenic
1079008352 11:16808699-16808721 AAGCACAGCCAGGAAGATGAGGG - Intronic
1079116959 11:17646103-17646125 AAAGGGAGCCAGGATGGGCAGGG - Intronic
1079321424 11:19454658-19454680 AAGGTGGGCCAGGCTGATGATGG + Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079996845 11:27304597-27304619 AACGGGAGCCAGGAAGAGGCGGG + Intergenic
1080215619 11:29836678-29836700 AAGGAGAGCCAGGTACATGATGG + Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081647317 11:44799048-44799070 AGGGAGGGCAAGGGTGAGGAGGG - Intronic
1081653559 11:44841668-44841690 ACGCAGAGCTAGGAAGAGGAGGG + Intronic
1081864647 11:46352792-46352814 GAGGAGAGCCAAGAAGAGCAAGG - Intronic
1081988871 11:47326960-47326982 GATGAGAGCCGGGATGTGGAAGG + Intronic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083185866 11:61017548-61017570 AAGGTGAGTCAGGATGGGAAGGG + Exonic
1083347101 11:62001320-62001342 CAGGAGAGCAAGGCTGGGGAGGG - Intergenic
1083490183 11:63009924-63009946 GAGGAGGGCCAGGCTGAGGAGGG + Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084528275 11:69711181-69711203 AAGGAGAGACGGGATGAACAAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084778951 11:71396351-71396373 AAGGAGATCCAGGGAGGGGAGGG + Intergenic
1085217253 11:74843692-74843714 AAGGAGAGCCAGCGTGAGGCAGG - Intronic
1085804200 11:79619474-79619496 AAGGACACCCAGGAAGAGCAAGG - Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088748855 11:112826962-112826984 AATGTAAGCCAGGCTGAGGAAGG - Intergenic
1088837538 11:113590531-113590553 AAGAAGGGCCAGGGTGAGGTGGG + Intergenic
1088920572 11:114257594-114257616 AAGAAAAGCCAGGATCAGGACGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089088302 11:115842905-115842927 AAGAAGAGCCAGGAAGAGAAAGG - Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090248506 11:125234974-125234996 AGTGAAAGCCAGGATGGGGAAGG - Intronic
1090334635 11:125954321-125954343 ATTCAGAGCCAGGATGCGGAAGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090815405 11:130289694-130289716 TAGGAGAGCCAGCCTAAGGATGG + Intronic
1090933881 11:131324478-131324500 AAGGAGAGACATGAAGTGGAAGG - Intergenic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091920493 12:4300477-4300499 AAGGAGGGACATGATGGGGAAGG + Exonic
1092084084 12:5741480-5741502 AAGGAGCGGTAGGAAGAGGAGGG - Intronic
1092509935 12:9144205-9144227 AAGGAAAGTGAGGATGAGGGAGG + Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093715157 12:22373421-22373443 GAGGAGAGACAGGATTAGAAAGG + Intronic
1093919089 12:24839227-24839249 AAGGAAAGCCAGACTGAGAATGG + Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094268838 12:28588937-28588959 AGGGAGAGCCAGGAGGTGGGTGG + Intergenic
1095446319 12:42286773-42286795 GAGGGGAGCCAGGCTGAGGGTGG + Intronic
1095484881 12:42674421-42674443 AAGGGCAGCCAGGAGCAGGATGG - Intergenic
1095556824 12:43516700-43516722 AAGAAGAGCAAGGATGATGAGGG - Intronic
1095804122 12:46299691-46299713 AAGTAGGGCCAGGAGGAGAATGG + Intergenic
1095957993 12:47817579-47817601 AGGGAGAGCCAAGCTGTGGAGGG + Intronic
1096046036 12:48563246-48563268 AGGGAGAGGCAGGAAGAAGAGGG - Intergenic
1096535136 12:52267217-52267239 AGGGAGTGCCAGGATGATGAAGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097078690 12:56413532-56413554 AGGGAGAGCCAGGAACAGGCAGG - Intergenic
1097222388 12:57458909-57458931 AAGCAGAGCTAGGATGTGGGAGG + Intronic
1097299980 12:58007698-58007720 AAGGAGAGATAGGATTTGGAAGG - Intergenic
1097987463 12:65799045-65799067 GAGGAGAGCTGGGATGAGGGAGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099948453 12:89272510-89272532 CAGGAGAGAGAGGATCAGGAAGG - Intergenic
1100355891 12:93829447-93829469 GGGGGTAGCCAGGATGAGGATGG + Intronic
1100703890 12:97179392-97179414 AAGTAAAGCAAGGATGAAGAAGG - Intergenic
1100865394 12:98852049-98852071 AAGGAGGGAAAGGATGATGATGG + Intronic
1101714853 12:107301794-107301816 AAAGTGAGCAAGGATGAGGTAGG - Intergenic
1102278209 12:111598853-111598875 GAGGAGACCGAGGACGAGGACGG + Exonic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1103832603 12:123791916-123791938 AATGACAGCAAGAATGAGGAAGG - Intronic
1104426174 12:128680037-128680059 AAGAACAGCCAGGATGAAGGAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106480331 13:30132962-30132984 ACGTAGAGCCGGGGTGAGGACGG + Intergenic
1108538629 13:51413921-51413943 AAGGAGAGACTAGATGTGGACGG - Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109649765 13:65310396-65310418 AAGGAGAGCCAGCAGGACAATGG - Intergenic
1110767613 13:79298925-79298947 AAGAAGGGCAGGGATGAGGATGG - Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1111337045 13:86838563-86838585 AAGGAGTGCGTGAATGAGGATGG + Intergenic
1112323282 13:98426527-98426549 AGGGAGAGACAAGAGGAGGATGG + Intronic
1112336593 13:98522000-98522022 AAGGAGAGAGTGGAGGAGGAGGG - Intronic
1113235499 13:108268511-108268533 AAGGAGAGCGAGGGTGAGGCAGG + Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114502463 14:23181062-23181084 AGGGCGAGCCAGGCTGAGGCAGG + Intronic
1114656568 14:24319283-24319305 AATGAGAGCCCAGAGGAGGATGG + Intronic
1114674445 14:24431004-24431026 GAGGAGAGCAGGGAAGAGGAGGG + Intronic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1115338003 14:32261432-32261454 ACTGAAAGCAAGGATGAGGAAGG - Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116654387 14:47632785-47632807 AAGGAGAGAGAGGTTGGGGAAGG - Intronic
1116688973 14:48080685-48080707 AGGGAGGGCCAAGATAAGGAGGG - Intergenic
1116967375 14:51028918-51028940 AAGGGGAGCCAGGGTCAGGGTGG - Intronic
1117178329 14:53168013-53168035 AAGGAGAGCTAGGACCAGCAAGG - Intergenic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1119543514 14:75455929-75455951 CAGCAGAGCCTGGATGCGGAAGG - Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120899909 14:89566867-89566889 AAGGAGGGTAAGGAAGAGGAGGG - Intronic
1121114696 14:91335456-91335478 AGGGAGAGCCAGGCAGAGGCAGG - Intronic
1121216384 14:92251582-92251604 AAGGAGAGCCAGAGAGAGAAGGG - Intergenic
1121265112 14:92596769-92596791 AAGGACAGCCATGGTGAGGAAGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121990621 14:98553373-98553395 AGGAAGAGAGAGGATGAGGAAGG - Intergenic
1122197091 14:100096363-100096385 AAGCAGAGTCTGGATGAGGCCGG - Intronic
1122227160 14:100286550-100286572 GAGGAGAGCAAGGCTGAGCAAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125753833 15:42049082-42049104 AGGCAGAGTCAGGAAGAGGAAGG + Intronic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1125915842 15:43486565-43486587 AAAGGGAGCAAGGGTGAGGAAGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126464243 15:48946442-48946464 AGGAAGAGGAAGGATGAGGAAGG - Intronic
1128054857 15:64691963-64691985 AGAGAGAGCCAGGATGGGGTGGG - Intronic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128431416 15:67598511-67598533 AAGGAGTGCAGGGAGGAGGAGGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1129161542 15:73750826-73750848 AAGGAGAGCAAGGAGAAAGAAGG + Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1130863187 15:87909169-87909191 ATGGACAGCAAGGAGGAGGAGGG - Intronic
1130926235 15:88387934-88387956 CAGGGGAGCCAGGATGACCAGGG + Intergenic
1130948895 15:88570242-88570264 GAGGAGAGCAAGGCTGGGGAAGG + Intergenic
1131675787 15:94668807-94668829 AAGAAGAGCCTTGAGGAGGATGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132763830 16:1524613-1524635 TACGAGAGCCAGGAGGAGGTCGG - Exonic
1132943166 16:2518518-2518540 AGGGTGAGCCAAGAAGAGGATGG - Intronic
1133068914 16:3232686-3232708 CAGGACAGCCAGGCTGAGAAGGG + Intronic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133736896 16:8622482-8622504 AAGGAGACCCAGGTTGCAGATGG - Intronic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135543340 16:23349002-23349024 AAGGAGAGAAAGGAGAAGGAAGG - Intronic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135934964 16:26771760-26771782 AAGCAGAGCAAGGAGCAGGATGG - Intergenic
1136555653 16:31006361-31006383 AAGCAGAGGGAGGATGAGAAAGG - Intronic
1137783064 16:51114073-51114095 GAGGAGAGCCGGGAGAAGGAAGG + Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138770235 16:59654062-59654084 AAGGAGAGCCAGCATGTTTAGGG + Intergenic
1139095014 16:63694903-63694925 AAGGAGAGCCATCAAGAGGTTGG + Intergenic
1139665709 16:68454022-68454044 AAGGTGAGCCTGGATGGAGAGGG + Intergenic
1139936202 16:70572890-70572912 AAGGACAGCCTGGAAGACGAGGG - Exonic
1140101619 16:71922538-71922560 AAGGAGGCCCTGGAAGAGGAGGG + Exonic
1140178423 16:72689099-72689121 AAGGAAAGCCAGGTTGGGCATGG - Intergenic
1140477154 16:75244684-75244706 GTGGAGAGCCAGGAGGAGCAAGG + Intronic
1140734035 16:77881992-77882014 ATGCACAGCCAGGATGGGGATGG + Intronic
1140800154 16:78479816-78479838 AATGAAAGCCAGGCTGAGGCTGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141910787 16:87057072-87057094 AAGGAAATCCAGGCTCAGGAAGG - Intergenic
1141926705 16:87174559-87174581 AAGAAGGGCCAGGCTGAAGAGGG - Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1143095631 17:4476975-4476997 AAGGACAGTCAGGATCAGGACGG - Intronic
1143103809 17:4518650-4518672 AGGAAGTGCCAGGATGGGGATGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143457622 17:7078124-7078146 AGAGAGTGTCAGGATGAGGAGGG + Intronic
1143629982 17:8133521-8133543 AAGGGCAGCCAGGAAGAGGCTGG - Intergenic
1143965797 17:10755837-10755859 AGGGAGAGAGAGGAGGAGGAAGG - Intergenic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1145083186 17:19912827-19912849 AAGGAGAGAAAGGCAGAGGAAGG + Intronic
1145242762 17:21249333-21249355 AAGTAGAGCCTGGATCAGGGAGG + Intronic
1145750551 17:27352596-27352618 AAGGAGAGTCAGGATGGTGGGGG + Intergenic
1146531309 17:33609853-33609875 AAGGAGAGAGGGGTTGAGGAAGG + Intronic
1147018343 17:37510564-37510586 AAATAGAGCCAGGAAGCGGAAGG - Intronic
1147134617 17:38427937-38427959 GAGGAGACCCAGGATCAGAAAGG - Intergenic
1147675564 17:42202671-42202693 AAGCTGGGCCAGGATAAGGATGG + Intronic
1148079602 17:44960399-44960421 GAGGAGAGAGAGGATGAGAAGGG + Intronic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1150148155 17:62788327-62788349 AGGGAGAGCCAGGGGCAGGAAGG - Intronic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150438703 17:65174045-65174067 ATGGAGAGCCAGGTTGGGGCTGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1151536259 17:74740597-74740619 GAGGAGAGACAGGGTGAAGATGG + Intronic
1151671570 17:75574152-75574174 AGAGAGAGCCAGGCCGAGGAGGG + Intronic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154316944 18:13311663-13311685 AAGGCGGGCCTGGATGTGGAGGG + Intronic
1155185573 18:23383877-23383899 AAGGAGCGGCAGGATGATGGGGG + Intronic
1155885489 18:31203375-31203397 AAGGACACCAAGGATGAGGTTGG + Intergenic
1156497729 18:37537033-37537055 CGGGAAAGCCAGGCTGAGGATGG - Intronic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1157222096 18:45835857-45835879 GAGGACAGTGAGGATGAGGAAGG + Intronic
1157680295 18:49600195-49600217 GAGGGGAGCCCTGATGAGGAAGG + Intergenic
1158644304 18:59230948-59230970 CAGGTGAGCCAGGTTGAAGATGG + Intergenic
1158659581 18:59374135-59374157 AAAGACAGCCAGGGTCAGGAGGG + Intergenic
1158686210 18:59616837-59616859 CAGGAAAGTCAGGATGAGAAAGG - Intronic
1158770619 18:60512782-60512804 AAGTAGACCCAGGAGGAGGCTGG - Intergenic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1159881450 18:73862065-73862087 AAGTAGAGCGAGTATGAGGGAGG + Intergenic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160293558 18:77617230-77617252 AAGGGGAGACAGGATCAGCAAGG + Intergenic
1160475677 18:79184455-79184477 AAGCAGAGCGAGGATGAGAAAGG - Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1161865996 19:6832570-6832592 GAGGAGGGCGAGGAGGAGGAAGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162185614 19:8902470-8902492 AATGATAGCAAGGATGATGATGG - Intronic
1162416395 19:10540625-10540647 AAGGAGACCAAGGATGGAGATGG + Intergenic
1162473799 19:10887964-10887986 AATGAGAGCCAGGGTGTGGAGGG + Intronic
1163164646 19:15487549-15487571 AAAAAGAGCCAGGCTGAGGCAGG - Intronic
1163407848 19:17134676-17134698 AAGGAGATCCTGGCTGAGCATGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163514516 19:17755016-17755038 AAGGAGAGAAAGGATGAAGGAGG - Intronic
1163595994 19:18221207-18221229 AAGGAGAGGCCGGATCCGGAGGG + Intronic
1163624683 19:18382401-18382423 AAGGAGAGCCAGGAGGAGCTGGG + Intronic
1163676011 19:18655665-18655687 ATGGAGAGCCAGGATGGGAGGGG + Intronic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164684387 19:30157315-30157337 GGGGAGAGCCAGGGGGAGGAAGG + Intergenic
1164763243 19:30743866-30743888 AAGGAGGGCCAGGCTGAGCATGG + Intergenic
1164767275 19:30781619-30781641 AAGCACAGCCAGGATGGAGATGG + Intergenic
1164779804 19:30883210-30883232 AAGGAGAGCACGGGTGAGGTAGG + Intergenic
1164833962 19:31345130-31345152 AAGGAAAGCCAAGAAGACGAAGG - Intronic
1165362376 19:35344883-35344905 ACAGATTGCCAGGATGAGGATGG - Exonic
1165682868 19:37792393-37792415 AAGGAGGCCCTGGAAGAGGAGGG + Intronic
1165990778 19:39811871-39811893 AAGGAGAGCCATGATGGACAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166175581 19:41066772-41066794 AAGTAGAGCCAGCATGTGCAGGG - Intergenic
1167064636 19:47175322-47175344 AAGGAGACCAAGGTTGAGCATGG + Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167369893 19:49074186-49074208 AAAGAGTGCCAGGATTAGCAGGG - Intergenic
1167479261 19:49719526-49719548 AAGAAGGGCCAGGGTGAGGGTGG - Intergenic
1167513222 19:49907952-49907974 AGGCTGAGCCAGGATGAGGTGGG + Intronic
1167554191 19:50183043-50183065 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1167586342 19:50377740-50377762 AAGGGGCGCCAGGCTGAGGGGGG - Exonic
1167593439 19:50416159-50416181 AGGGGAAGCAAGGATGAGGAAGG - Intronic
1167719508 19:51168716-51168738 ATGGTGAGTCAGGATGAGGCAGG - Intergenic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168639262 19:58019964-58019986 AAGGAAAACCAGGATGATGGTGG + Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925030047 2:643351-643373 AAGAAGAGAGAGGATGAGAAAGG + Intergenic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
925958265 2:8990985-8991007 AAGTAGAGCCAAGAAGATGAAGG - Intronic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926453771 2:13039929-13039951 ACGGAGAGCGAGGAAAAGGAGGG + Intergenic
926696162 2:15771316-15771338 GAGGAGACCCAGGGTGGGGACGG + Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927732604 2:25487836-25487858 GAGGAGAGGCAGGATGTGAAAGG + Intronic
928214814 2:29352436-29352458 TAGGAGAGCAAGGTTGGGGAGGG - Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929278027 2:40046338-40046360 AGGGAGAGCCAGGATGAAACAGG - Intergenic
929379966 2:41337928-41337950 AAAGAGAGTCAGAATAAGGAAGG + Intergenic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
929944531 2:46360624-46360646 AACCAGAGCCTGGATGTGGAAGG - Exonic
930692814 2:54381685-54381707 CAGGAGTGAAAGGATGAGGAAGG - Intronic
931162066 2:59703177-59703199 AGGGAGAGCCAAGTGGAGGAGGG + Intergenic
931376587 2:61713532-61713554 AGAGGCAGCCAGGATGAGGAGGG + Intergenic
931418933 2:62107860-62107882 ATGGAGAGCTATTATGAGGAAGG - Intronic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932580940 2:72992370-72992392 AAGGAGACACTGGATGAGGCTGG + Intronic
933042464 2:77487150-77487172 AATGGGAGCCAGGAACAGGAGGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934813596 2:97305307-97305329 AAGGACAGCGAGGCTGGGGAAGG - Intergenic
934824099 2:97403173-97403195 AAGGACAGCGAGGCTGGGGAAGG + Intergenic
935168387 2:100589779-100589801 AAGGACAGCCCGGAAGTGGAGGG - Intergenic
935620566 2:105126096-105126118 AAGGCGGGCCAGGATGTGGAGGG - Intergenic
935830417 2:106996105-106996127 AAGGAGAGAAATGATGTGGAAGG - Intergenic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936078822 2:109418552-109418574 AAGGAGGACCGGGATGTGGAGGG - Intronic
936290528 2:111220377-111220399 AAGGAGACCAAGGAACAGGATGG - Intergenic
936509117 2:113131350-113131372 AAAGAGAGCCTGGAGGATGAGGG - Intronic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937765099 2:125651940-125651962 AAGGAGTGCCAGGAGCAGAAAGG - Intergenic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938127670 2:128686249-128686271 AAGGAGCCCCAGGATGGGGATGG - Intergenic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939387721 2:141522397-141522419 AAGGAGAGCCTGAATGTGGCAGG + Intronic
941144652 2:161829350-161829372 AAGTACAGCCAGGCTGAAGACGG + Intronic
942409806 2:175697211-175697233 AGGCAGAGTCAGGATGACGACGG + Intergenic
943044204 2:182839175-182839197 ACAGTGAGCCAAGATGAGGAAGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
944772209 2:202925832-202925854 AAGGAGAGCCAGGTGGAGTCTGG + Intronic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946026968 2:216677728-216677750 AAGGAGAGCCTGGCTGTGAAGGG + Intronic
946070435 2:217030113-217030135 AAGAAGGGCCAGGATAAGGTGGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946256911 2:218449066-218449088 CAGGAGAGCCAGGAAAGGGATGG - Intronic
946705464 2:222454415-222454437 TAGGAGAGCTTGGATGAGGAAGG + Intronic
946743228 2:222820428-222820450 AAGGAGAGGCAAGATGAAAAAGG - Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947976330 2:234369396-234369418 AATGATAGCCAAGATGACGAGGG - Intergenic
948156723 2:235789050-235789072 AAGGAGTGCATGGAAGAGGAAGG + Intronic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948624843 2:239262600-239262622 AAATGGAGCCAGGCTGAGGATGG - Intronic
948724168 2:239921709-239921731 GAGGAGACCCGGGATGAGGCCGG + Intronic
948816595 2:240513459-240513481 AGGGAGAGCCCGGCTGAGAATGG + Intronic
948855674 2:240729475-240729497 AAGGAGCCCCAGGATGGGGCAGG - Intronic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1168811016 20:704597-704619 AGGGAGACCCAAGGTGAGGATGG - Intergenic
1168867931 20:1105050-1105072 AAGGAAGGCCAGGCTGAGAAGGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169781109 20:9311658-9311680 AAACAGCTCCAGGATGAGGAGGG - Intronic
1170345745 20:15384917-15384939 AAGCAGAGCCAGATTAAGGAGGG - Intronic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1170702284 20:18714119-18714141 AAGGAAAGGCAGGATGAGAAAGG + Intronic
1171444976 20:25196454-25196476 CAGGAGAGCGTGGAAGAGGAAGG + Intronic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172194276 20:33081514-33081536 AAGCAGTGCCAGCATGTGGATGG + Exonic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172355395 20:34276392-34276414 CACGAGAGACAGGTTGAGGAGGG + Intergenic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173605330 20:44327211-44327233 TGGGAGGGCAAGGATGAGGAGGG + Intergenic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174300112 20:49575683-49575705 CAGGAGAGCCAGGATTATGTAGG + Intergenic
1174306677 20:49618375-49618397 AAGGAGGTCAAGGGTGAGGACGG - Intergenic
1174338613 20:49882413-49882435 AAGGAGAGAAAGGAGGAGCATGG - Intronic
1174532066 20:51222048-51222070 AGAGAGAGCCAGGGGGAGGAGGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175871947 20:62213153-62213175 AAGGAGAGCGGGGATGGGGGGGG + Intergenic
1175871966 20:62213201-62213223 AAGGAGAGCGGGGATGGGGGAGG + Intergenic
1175872001 20:62213286-62213308 AAGGAGAGCGGGGATGGGGGAGG + Intergenic
1175872057 20:62213421-62213443 AAGGAGAGCGGGGATGGGGGAGG + Intergenic
1175872128 20:62213593-62213615 AAGGAGAGCGGGGATGGGGGAGG + Intergenic
1175872165 20:62213680-62213702 AAGGAGAGCGGGGATGGGGGAGG + Intergenic
1176159571 20:63641494-63641516 AAGGCCAGCCCGGATGAGGCCGG - Intronic
1176676114 21:9778960-9778982 AATCTGAGTCAGGATGAGGAAGG + Intergenic
1177236460 21:18396116-18396138 AATGAAAGCCAAGATGAGCATGG - Intronic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178096057 21:29217049-29217071 AAGGAGTGCCAGGAAGTGGAAGG + Intronic
1178845330 21:36169756-36169778 AAGAAATGGCAGGATGAGGATGG - Intronic
1179412619 21:41174002-41174024 AAGGAGATCAGGGATGAGTATGG - Intronic
1179829608 21:43988364-43988386 AAGAAGAGACATGAAGAGGATGG - Intergenic
1180171395 21:46060553-46060575 ACTGAGAGCCAGGGTGGGGAAGG - Intergenic
1180179292 21:46110901-46110923 AAGGAAAGCCAGGCTAATGACGG + Intronic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1180953135 22:19729776-19729798 ACGGAGAGCCGGCAAGAGGAGGG - Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181260749 22:21595457-21595479 AAGTAGAGCCAGGCCGATGAAGG + Intronic
1181313538 22:21958122-21958144 AATGAGGACGAGGATGAGGATGG + Intronic
1181346647 22:22224194-22224216 AATGAGGACGAGGATGAGGATGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181632343 22:24157779-24157801 AAGCGGAGCCAGGAAGGGGATGG - Intronic
1181662459 22:24362307-24362329 CAGGTTAGCCAGGATTAGGAGGG + Intronic
1182006018 22:26960297-26960319 AGGGAGAGAAAGGAGGAGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182421021 22:30248628-30248650 CAGGAGAGCCAGGCTGAGTCAGG - Intergenic
1182777817 22:32843839-32843861 AAGGACAGCAAGGATAAGTAAGG - Intronic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183121273 22:35731925-35731947 AAGAAGAGCCAGGATAACGGGGG + Intergenic
1183679107 22:39316782-39316804 AAGAAATGGCAGGATGAGGATGG - Exonic
1183806873 22:40219308-40219330 AAGGAGAGCTTGGAGTAGGAAGG + Intronic
1184018015 22:41800471-41800493 CAGGAGGGACAGGACGAGGATGG + Intergenic
1184067427 22:42128630-42128652 AAGAAGGGCCTGGAGGAGGAGGG - Intronic
1184070157 22:42142325-42142347 AAGAAGGGCCTGGAGGAGGAGGG - Intergenic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
950655648 3:14434734-14434756 GAGAAGGGCCAGGATGAGGCAGG - Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951170735 3:19539093-19539115 AGGGAGAGCCAGGAAGAAGTTGG - Intergenic
951174850 3:19587109-19587131 AGGGAGAGCCAGTAAGAGAATGG + Intergenic
951808170 3:26669985-26670007 AAGCAGAGCAAGGTGGAGGAAGG - Intronic
952227810 3:31396886-31396908 AAGGAGAGTCAGGATGTATATGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953463567 3:43100946-43100968 TGGGGCAGCCAGGATGAGGAAGG + Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
953856506 3:46503415-46503437 AAGGAGAGCCAGCACAAGTAGGG + Intergenic
954614547 3:51962941-51962963 AAGGGCAGCCAGCATGAGGCTGG - Intronic
955054314 3:55442400-55442422 AAGGAGGGCCAGGCTGAGCATGG - Intergenic
955080594 3:55654859-55654881 AATGAGAGACAGGCAGAGGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956181939 3:66525285-66525307 AAGAAGAGCCAGGAGGGGTAAGG - Intergenic
956806767 3:72821978-72822000 CAGGAGAGCCAGGAGTTGGATGG - Intronic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959531078 3:107434107-107434129 AAGGAAGGCCAGGCAGAGGATGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960529498 3:118747235-118747257 AGAGAAAGCCAGGAAGAGGACGG + Intergenic
960871596 3:122255117-122255139 GAGGACAACCAGGATGATGACGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961147117 3:124603518-124603540 AGGGAGAGCCAGGGACAGGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961645424 3:128390354-128390376 AAGCACAGCCAGGCTCAGGAGGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963320771 3:143807012-143807034 TCGGAGAGCCAGTATGAGGAAGG - Intronic
963989026 3:151631824-151631846 AAGGAGAGGCAGGAGGAGCCAGG + Intergenic
964374419 3:156035537-156035559 AAGGAGGGGGAGGAAGAGGAAGG - Intergenic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966816947 3:183897073-183897095 AAGTGGAGCCAGGATGGGGTCGG + Intergenic
966924748 3:184636942-184636964 AAGGAGAGCTAGAATTGGGAGGG - Intronic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967881152 3:194302658-194302680 AAGCAGAGCAAGGATGGAGAAGG + Intergenic
967948179 3:194820558-194820580 AAGGAGAACCATGGAGAGGAGGG + Intergenic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969163288 4:5280424-5280446 AGGGAGAGTCAGGAAGATGAGGG - Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969602249 4:8183228-8183250 AACGAGGGGGAGGATGAGGACGG - Intronic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970342800 4:15124341-15124363 TAGGAGAGCAAAGAAGAGGAGGG + Intergenic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972322282 4:37983022-37983044 AATGAGGACCAGGATGAGCATGG + Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974368968 4:60989117-60989139 AAGCAGGGCCTGGGTGAGGATGG - Intergenic
975260059 4:72287512-72287534 AGAGAGAGCCAGGAAGAGGCAGG + Intronic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
976104943 4:81606544-81606566 AATGAGTGACAGGATGAGGTTGG - Intronic
976387682 4:84480270-84480292 AGAGATAGCCAAGATGAGGAAGG + Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977537590 4:98273094-98273116 GACGAGAGCCTAGATGAGGAGGG - Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977892362 4:102326849-102326871 TAGGATAACCAGGATGAGAAGGG - Intronic
978269373 4:106870625-106870647 AAGGAGAGTGAGGATGATAAAGG + Intergenic
978555876 4:109979790-109979812 AAGGAAAGCCCACATGAGGAGGG - Intronic
980657736 4:135811741-135811763 AAGGAGAGGAAAGATTAGGAAGG + Intergenic
981124218 4:141087415-141087437 AAGGAGAGGCTGGATAAAGATGG - Intronic
981632599 4:146837731-146837753 AAACAGAGCCAGGATCAGGATGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983777707 4:171629056-171629078 GGGGAGATTCAGGATGAGGACGG + Intergenic
983935854 4:173502157-173502179 AGGGAAAGCCAGGTTGAGGAAGG - Intergenic
984261868 4:177452323-177452345 AAGGAGAGGCGGGGAGAGGAGGG - Intergenic
984504422 4:180598963-180598985 AAGAAGAGCCAAGATAGGGATGG - Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984573963 4:181425948-181425970 ATGGGGAGCCAGGAAGACGAAGG + Intergenic
984612324 4:181855812-181855834 AAGGAGAGAAAGGGAGAGGATGG + Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985399414 4:189579786-189579808 AATCTGAGTCAGGATGAGGAAGG - Intergenic
985670782 5:1205528-1205550 AAGGAGAGCCACCAGGAGCAAGG + Intronic
985773231 5:1825809-1825831 AAGGAGAGCCGGGCAGAGGCAGG - Intergenic
985912758 5:2896382-2896404 AAGAAGAGCGAGGATAAGAAGGG - Intergenic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987246457 5:16054093-16054115 ACTGAGAGCCAAGATGGGGATGG + Intergenic
987325416 5:16807816-16807838 AAGGAGCGTCACAATGAGGAGGG - Intronic
987551857 5:19393113-19393135 GAGTAGAGCCAGGATCATGATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988493586 5:31726105-31726127 AAGGAAAGGCAGGCTCAGGACGG - Intronic
988497265 5:31756094-31756116 AAGGTCAGTCATGATGAGGAAGG + Intronic
988964240 5:36400645-36400667 AAGGAGGCCCAGGATCGGGAGGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990960773 5:61391447-61391469 AAGAAATGTCAGGATGAGGATGG - Intronic
991198087 5:63959658-63959680 GGGGAGAGCAAGGAGGAGGAGGG - Intergenic
991198241 5:63960619-63960641 AACAAGAGCCACGATGAAGAAGG + Exonic
991508823 5:67354218-67354240 AAGGACAGCAAGGCTTAGGAGGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
994241745 5:97430597-97430619 AAGGAGAGCCAGGAAAGGAAAGG - Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995183498 5:109249895-109249917 AAGGAGAGCAAGAATGATCAAGG + Intergenic
995189892 5:109309043-109309065 CTGGAGTGCCAGGATGGGGATGG + Intergenic
995687956 5:114791683-114791705 CAGGAGATCCAGGTAGAGGATGG + Intergenic
995847494 5:116509735-116509757 AAGGGGACCCAGGCTGAGGTGGG + Intronic
996352831 5:122564271-122564293 AAGAAGAGCGAGGATGAGACGGG + Intergenic
996511934 5:124326323-124326345 AAGGAGAGCCAGCCTTAGGGGGG - Intergenic
997443614 5:133925893-133925915 AAGGAAGGCCAGGCTGGGGAGGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997852095 5:137342202-137342224 AAGGAGGGCCAAGGTGAGGCTGG - Intronic
998249417 5:140541494-140541516 AAGTAGTGCCAGGAAGAGGCAGG - Intronic
998788717 5:145743540-145743562 ATGGAGAGCAAGGAAGAGCAGGG + Intronic
998988418 5:147788356-147788378 AAGGAAAGAAAGGATGAAGAAGG + Intergenic
999200066 5:149809954-149809976 AAGGCGTTCCAGGCTGAGGAAGG + Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999779529 5:154837862-154837884 CAGGAGAGCCAAGAGGAGAAGGG + Intronic
999801553 5:155042884-155042906 AAGCAGAGCCAGGAAGAGTAGGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1000987153 5:167873698-167873720 AAGGAGACCTGGGATGAGGGAGG + Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002641434 5:180632397-180632419 AGGGAGAGCCCGGAGGAGGCTGG - Intronic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003425640 6:5996622-5996644 GAGGAGAACCAGGATAAAGAGGG - Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1004243851 6:13953441-13953463 TAGGAGAGACTGGGTGAGGATGG + Intronic
1005312168 6:24569273-24569295 AGGGAGAGCATGGAAGAGGAGGG + Intronic
1006044216 6:31280710-31280732 AAGAAATGGCAGGATGAGGATGG + Intronic
1006896605 6:37475346-37475368 AAGGACATCGAGGATGTGGATGG - Exonic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007542929 6:42666625-42666647 AAGGAGAGCCAGGTAAAGAAAGG - Intronic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007936531 6:45737469-45737491 GAGCAGAGCCAGTCTGAGGAGGG - Intergenic
1008679443 6:53856808-53856830 AAGGACAGCCTGGATGTGGGAGG + Intronic
1008898881 6:56588358-56588380 AAGAAGAGCCAAGTTCAGGATGG - Intronic
1008911906 6:56743475-56743497 AAGGAGAGATAGGAAGAGAAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010966372 6:82213850-82213872 AGGGAGAGAGAGGAAGAGGAGGG + Intronic
1011195747 6:84777523-84777545 AGGAAGTGGCAGGATGAGGAAGG - Intergenic
1011741127 6:90361871-90361893 AAGGTGAGCCTGGAGGAGGTGGG - Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013394594 6:109722646-109722668 AATGAAAGCCAGAATGAAGAGGG - Intronic
1013618051 6:111862990-111863012 GAGGTGAGCCAGGATGACTAAGG + Intronic
1014814168 6:125917341-125917363 AAGGAAAGCAGTGATGAGGAAGG - Intronic
1015228217 6:130882912-130882934 AAGGACAGTCAGGCTGAGAAGGG + Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015699469 6:136019899-136019921 GAGGAGAGGGAGGAAGAGGAAGG + Intronic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1016922859 6:149313457-149313479 AAGGAGAGGAAGGGTGACGAGGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017702985 6:157094160-157094182 AAGGAGATCCAGGCAGAGAACGG + Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018319635 6:162593720-162593742 AAGGAGAGTCAGGATAGGGCAGG + Intronic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1020116703 7:5480203-5480225 ACGGAAACCCAGGAGGAGGAAGG + Intronic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020139393 7:5604289-5604311 AAGGAGAGCAGGGAAGGGGAGGG + Intronic
1020285871 7:6680144-6680166 AAGGAAATCCAGGTAGAGGAGGG - Intergenic
1020682959 7:11259303-11259325 AAGGACAGCCAGAAATAGGAAGG - Intergenic
1021979763 7:26043122-26043144 AAGGAGAGGAAGGATGATAAAGG - Intergenic
1022446287 7:30473267-30473289 AAGGAGAGGGAGGATGAGTAAGG + Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023762966 7:43483875-43483897 AATGAAAGCCAAGAAGAGGAAGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026517818 7:71087876-71087898 AAGGAGTGGCAGGAGGAGGCGGG + Intergenic
1026535689 7:71236861-71236883 AAAGAAAGCCAGGACGGGGAAGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027367396 7:77472743-77472765 AAGGAGAGGAAGGATTAAGAGGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1029459961 7:100688722-100688744 AAGGAGAGCAGGGGGGAGGAGGG + Exonic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030736750 7:113058066-113058088 AAGGAGAGCTAGGATGAAGTGGG - Intergenic
1031072235 7:117174556-117174578 AAGGAAAGCCAGGATAAAAACGG + Intronic
1031867089 7:127049665-127049687 TAGGAGAGCCATGAGAAGGAGGG + Intronic
1032520295 7:132538710-132538732 CAGGAGAGCCAGGATGCTGTAGG + Intronic
1032819246 7:135509743-135509765 AAGAAGACCAAGGAGGAGGAGGG + Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033225234 7:139556572-139556594 AAGTAAATCCAGGCTGAGGAAGG - Intergenic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1034099055 7:148436105-148436127 AGGAAGAGCCAGCATGGGGAGGG + Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034228712 7:149502175-149502197 AGGGAGGTCCAGGGTGAGGAGGG - Intergenic
1034670600 7:152854766-152854788 AGGGAGAGCGAGGGTGAGGAGGG - Exonic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1036167779 8:6453138-6453160 TGGGAGAGTCAGGAAGAGGAGGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1037590802 8:20310550-20310572 AAGGAGGGCCAGGACATGGACGG - Intergenic
1037747582 8:21659240-21659262 TGGGAGTGCCAGGATGGGGAGGG - Intergenic
1038663917 8:29520910-29520932 AAGGTGTGCAAAGATGAGGAAGG - Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039510709 8:38089870-38089892 GAGGAAATCCAGGATGAGGTTGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1039766368 8:40632630-40632652 AAGGAAAGCCAGGAGAAGCAAGG + Intronic
1039838807 8:41279014-41279036 AAGGAGAGCCAGGAAGGCCAAGG - Intronic
1040718388 8:50287132-50287154 AAAGAAAGCCAGGATAAGGATGG - Intronic
1040842507 8:51799706-51799728 AAGGTGAGCCAGGAAGGGAACGG + Intronic
1040914977 8:52559473-52559495 AAGGAGAGTGAGGAGGAGAAAGG - Intronic
1040941362 8:52836633-52836655 AAGGAGAGGCAGGATCAGAGTGG + Intergenic
1041570112 8:59328378-59328400 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1042230523 8:66549778-66549800 AAGGAGATCCTGGATGGGCATGG + Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042490640 8:69393791-69393813 AGTGAGAGCCTGGATGAAGAAGG + Intergenic
1044305446 8:90635297-90635319 AAAGATAGATAGGATGAGGAAGG + Intronic
1044611366 8:94095494-94095516 AGGCAGAGCCAGCATGAGAATGG + Intergenic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045155774 8:99468932-99468954 AAGAAAAGAAAGGATGAGGATGG - Intronic
1047025951 8:120824795-120824817 AAGGAGAGAGAGGAGTAGGAAGG - Intergenic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047518689 8:125577790-125577812 AAGAAGAGAAAGGAGGAGGAAGG - Intergenic
1047701867 8:127456897-127456919 TAGGAGGGCCAGGGTAAGGAGGG - Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1048683007 8:136867398-136867420 AAGAAGATCCAGGATGGTGAAGG - Intergenic
1049056040 8:140238405-140238427 AAGGAGACCCAGCACCAGGAAGG + Intronic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049782164 8:144434056-144434078 AAGGAGGGCCAGGCTGGGCATGG + Exonic
1050479527 9:6075400-6075422 AAAGAGAGCCTGGAGGAGGGAGG - Intergenic
1051147337 9:14041441-14041463 AAGAAATGGCAGGATGAGGATGG - Intergenic
1052817858 9:33115466-33115488 AAAGAGCCCCAGGATGTGGATGG + Intronic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054713838 9:68537863-68537885 AAAGGGAGCAAGGATGTGGATGG - Intronic
1055147134 9:72949333-72949355 AATGAAAGTCAGGATGAAGAAGG + Intronic
1055432012 9:76253539-76253561 GAAGAAAGCCAGGATGAGTAAGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055807059 9:80107669-80107691 AAGTAGAGCAAGGAAGAGGAGGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1057530590 9:95842220-95842242 AAAGAGCTCCAGGATGAGGGGGG - Intergenic
1057588258 9:96348706-96348728 AGGAAGAGCCAGGCTGAGCATGG + Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059710317 9:116861873-116861895 AAGCAGAGCTAAGATAAGGAGGG + Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062562239 9:137146737-137146759 GAGGAGGCCCAGGCTGAGGAGGG + Intronic
1062568989 9:137175840-137175862 AAGGAGGGCCAGGGTCAGCACGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185844959 X:3429058-3429080 AATAAAAGCCAGGAAGAGGAAGG + Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187808591 X:23149930-23149952 AATGAGAGTCAGGCTGAGGCGGG + Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190780183 X:53586489-53586511 AAGGAGAGCCCAGATGACTAAGG - Exonic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192252515 X:69424405-69424427 AAAGAAAGCCAGGTTTAGGAAGG + Intergenic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1193199807 X:78675381-78675403 GAAGAGTGCCAGGATGATGAGGG - Intergenic
1195462654 X:105145025-105145047 AAAGAGGGCCTGGCTGAGGACGG + Intronic
1195812572 X:108851060-108851082 AAGGAGAGCAAGGAAAAGCAGGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1198944244 X:141992218-141992240 AAGAAGAGTCAGGATGACTAAGG + Intergenic
1200045513 X:153398769-153398791 AGGGATACCCAGGATGAGCAGGG + Intergenic
1201342242 Y:12947182-12947204 TAGGAGAACCAGGATGGGCATGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic