ID: 1013374976

View in Genome Browser
Species Human (GRCh38)
Location 6:109505898-109505920
Sequence ATTTGCTGGTACCTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1373
Summary {0: 1, 1: 0, 2: 23, 3: 211, 4: 1138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013374976_1013374980 -7 Left 1013374976 6:109505898-109505920 CCAGAATCAAGGTACCAGCAAAT 0: 1
1: 0
2: 23
3: 211
4: 1138
Right 1013374980 6:109505914-109505936 AGCAAATCTGGTATCTGGAGAGG No data
1013374976_1013374981 12 Left 1013374976 6:109505898-109505920 CCAGAATCAAGGTACCAGCAAAT 0: 1
1: 0
2: 23
3: 211
4: 1138
Right 1013374981 6:109505933-109505955 GAGGCACTGTTCCTCATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013374976 Original CRISPR ATTTGCTGGTACCTTGATTC TGG (reversed) Intronic
901172615 1:7271312-7271334 ATTTGCTGGCATCTTGATCATGG + Intronic
901197562 1:7448613-7448635 ACCTGCTGGTACCTTGATCTTGG - Intronic
901360031 1:8690161-8690183 ATCTGCTGGCACCTTGATCTTGG - Intronic
901833065 1:11905964-11905986 ATTTGCTGATGCCTTGATGTTGG - Intergenic
902131438 1:14264629-14264651 AGATGCTGGTACCTTGTTACTGG + Intergenic
902907753 1:19571283-19571305 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
903479761 1:23644713-23644735 ATCTGCTGGCACCTTGATCTTGG + Intergenic
904282648 1:29432113-29432135 ATCTGCTGACACCTTGATTGTGG - Intergenic
904895276 1:33812622-33812644 ATTTGCTGGTCGCTTAAGTCTGG + Intronic
904958882 1:34314860-34314882 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
905382195 1:37570630-37570652 AGATGCTGGTGCCTTGATACTGG + Intronic
905485647 1:38293981-38294003 ATCTACTGGCACCTTGATTTTGG - Intergenic
905496808 1:38395775-38395797 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
905826830 1:41032103-41032125 ATCTGCTGGTGCCTTGATCTTGG + Intronic
905953380 1:41971997-41972019 ATCTGCTGGTGCCTTGATCTTGG + Intronic
905984694 1:42268990-42269012 ATCTGCTGGCATCTTGATTTTGG + Intronic
906131532 1:43461585-43461607 ATCTGCTGGCACCTTGATGTTGG + Intergenic
906436096 1:45797966-45797988 ATTGGCTAGAACCTTGATTTTGG - Intronic
906441027 1:45844888-45844910 AGATGCTGGTACCTTGATCTTGG - Intronic
906677630 1:47704734-47704756 AGTTGCTGGCACCTTGATCTTGG - Intergenic
906697861 1:47836867-47836889 ATATGCTGGTGCCTTGATCTTGG + Intronic
907390886 1:54157573-54157595 ATCTGCTGGCACCTTGATCTTGG - Intronic
907534048 1:55132237-55132259 ATCTGCTGGTGCCTTGATCTTGG + Intronic
908016578 1:59845099-59845121 ATCTGCTGGTACCTTGATTTTGG - Intronic
908121973 1:60994404-60994426 ATCTGCTGGCACCTTGATTTTGG - Intronic
908326621 1:63029658-63029680 ACCTGCTGGTGCCTTGATTTTGG + Intergenic
908341034 1:63179345-63179367 ATCTGCTGGTACCTTGATCTTGG + Intergenic
908388519 1:63664778-63664800 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
908810230 1:67974847-67974869 ATGTGCTGGTGCCTTGACTTGGG - Intergenic
908965029 1:69750630-69750652 ACTTGCTGGCACCTTGATCTTGG - Intronic
909020428 1:70425370-70425392 ATCTGCTGGCACTTTGATTGAGG - Intronic
909089725 1:71210310-71210332 ATTTGGCCTTACCTTGATTCAGG + Intergenic
909103457 1:71379515-71379537 ATTTGCTGGCACCCTGATCTTGG + Intergenic
909192245 1:72568733-72568755 TTTAGCTGTTACCTTGAATCTGG - Intergenic
909959311 1:81819300-81819322 CTTGGCTGGAACCTTGGTTCTGG - Intronic
910359569 1:86402346-86402368 ATTGGCTGGCACCTTGATCTTGG - Intergenic
910623299 1:89279496-89279518 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
910898063 1:92089567-92089589 ATCTGCTGGCACCTTGATCTTGG - Intronic
910956488 1:92711901-92711923 ACTTGCTGGTGCCTTGATCTTGG - Intronic
911028494 1:93460342-93460364 TTTTCCTGGCACCTTGATTTTGG + Intronic
911108297 1:94155605-94155627 ATCTGCTGGTGCCTTGATCTTGG + Intronic
911349876 1:96740260-96740282 CCTTGCTGGTACCTTGATCTTGG - Intronic
911631203 1:100185532-100185554 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
911885429 1:103291683-103291705 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912351031 1:109013186-109013208 ATCTGCTGGTACCTTGATCTTGG + Intronic
912364323 1:109120519-109120541 ATCTGCTGGTGCCTTGATCTTGG + Intronic
912547519 1:110461580-110461602 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912908736 1:113734907-113734929 ATCTTCTGGCACCTTGATCCTGG + Intronic
913067455 1:115269610-115269632 ATCTGCTGGCACCTTGATCTTGG + Intergenic
913067674 1:115271562-115271584 ATTTGCCAGAACCTTGATGCTGG - Intergenic
913468083 1:119163701-119163723 ATTTGCTGCCACCTTGATCTTGG + Intergenic
913595489 1:120371998-120372020 ATCTGCTGGCACCTTGATCTTGG + Intergenic
914091787 1:144506977-144506999 ATCTGCTGGCACCTTGATCTTGG - Intergenic
914306754 1:146426887-146426909 ATCTGCTGGCACCTTGATCTTGG + Intergenic
914325502 1:146611531-146611553 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
914595295 1:149145915-149145937 ATCTGCTGGCACCTTGATCTTGG - Intergenic
915100746 1:153497744-153497766 ATCTGCTGGCACCTTGATCTTGG + Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
915718731 1:157967867-157967889 ATCTGCTGGCACCCTGATTTTGG + Intergenic
915766575 1:158368512-158368534 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
915826377 1:159082414-159082436 ATATGCTGGTACCTTGATCTTGG - Intronic
915926134 1:160021031-160021053 ATCTGCTGGCACCTTGATCTCGG + Intergenic
916125330 1:161565400-161565422 ATTTGCTGATACCTTGCAGCAGG + Intergenic
916135216 1:161646790-161646812 ATTTGCTGATACCTTGCAGCAGG + Intronic
916149869 1:161776556-161776578 ATTTTCTGGTAGATTGATTATGG + Intronic
916334048 1:163650169-163650191 ATCTGCTGGTGCCTTGATCTGGG - Intergenic
916376583 1:164161158-164161180 ATTTGCTGTCACCTTGATTTTGG - Intergenic
916686955 1:167156255-167156277 ATCTGCTGGCACCTTGATCTTGG - Intergenic
916899641 1:169207081-169207103 AGATGCTGGTACCATGCTTCTGG - Intronic
917124008 1:171670232-171670254 CCTTGCTGGAACCTTGATTTTGG - Intergenic
917354815 1:174115957-174115979 ATATGCTAGTCCCTTGATTTTGG + Intergenic
917652968 1:177096980-177097002 ATCTGCTGGCACCTTGATCTTGG + Intronic
917725054 1:177820453-177820475 GTCTGCTGGTACCTTGACGCAGG + Intergenic
917835241 1:178936789-178936811 ATCTGCTGGTATCTTGATGTTGG - Intergenic
918041933 1:180918900-180918922 ATCTGCTTGTGCCTTGATCCTGG - Intronic
918150736 1:181796341-181796363 ATCTGCTGGTACCTTGGTCTTGG - Intronic
918617414 1:186561951-186561973 ATTTGCTGGTACATTTAATATGG + Intergenic
918630501 1:186711894-186711916 ATCTGCTGGCACCTTGATCTTGG - Intergenic
918759666 1:188386839-188386861 ATCTGCTGGTACTTTGATCTTGG + Intergenic
918977892 1:191513902-191513924 ATATGCTGGTACCTTGTTCTTGG + Intergenic
919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG + Intergenic
919067568 1:192712886-192712908 ATTTGTTGGCACCTTGATATAGG + Intergenic
919160334 1:193821685-193821707 ATCTGCTGGCACCTTGATTTTGG - Intergenic
919440745 1:197630296-197630318 ATCTGCTGGTACCTTGATGTTGG - Intronic
919461843 1:197885924-197885946 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
919462423 1:197893867-197893889 ATCTGCTGGCACCTTGATCTTGG - Intergenic
919511435 1:198470296-198470318 GTTTGCAGGTACCTTGATCTTGG + Intergenic
919539884 1:198833135-198833157 ATCTGCTGGTACCTTTATCTTGG + Intergenic
919719132 1:200813118-200813140 ATCTGCTGGCACCTTGATCTGGG - Intronic
919841486 1:201612520-201612542 ATCTGCTGGCACCTTGATCTTGG - Intergenic
920411197 1:205762252-205762274 ATTTGCTGGCACCTTGATCTTGG + Intergenic
920816320 1:209336342-209336364 ATCTGCTGGCACTTTGATTTAGG + Intergenic
920975660 1:210782860-210782882 ATCTGCTGGCACCTTGATCTTGG + Intronic
921032854 1:211349332-211349354 ATCTGCTGGTGTCTTGATTGTGG - Intronic
921103451 1:211951730-211951752 ATCTGCTGGCAGCTTGATACTGG + Intronic
921132459 1:212231520-212231542 ATCTGCTGGTACTTTGATCTTGG + Intergenic
921249759 1:213285923-213285945 ATCTGCTGGCACCTTGGTTCTGG + Intergenic
921686476 1:218094829-218094851 ATCTGCTGGCACCTTGATCTTGG + Intergenic
921861160 1:220043701-220043723 ATTTCCTGGTGTCTAGATTCAGG - Intronic
921990333 1:221359316-221359338 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922006814 1:221539496-221539518 ATCTGCTGGCACCTTGATCTCGG + Intergenic
922027397 1:221763605-221763627 ATTTGCTGGCACCTTGACCTTGG - Intergenic
922070744 1:222190716-222190738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922094734 1:222433669-222433691 ATTTGCTAGCACCTTGATCTTGG - Intergenic
922254269 1:223878967-223878989 ATCTGCTGGTGTCTTGATTTTGG - Intergenic
922483498 1:225955839-225955861 ATTTGCTACTGCCATGATTCAGG - Intergenic
922527869 1:226319985-226320007 AATTGCTTGAACCTTGAATCTGG - Intergenic
922929396 1:229377041-229377063 ATCTGCTGGTACCTTGATCTTGG + Intergenic
923411445 1:233713852-233713874 ATCTGCTGGTACCTAGATCTTGG + Intergenic
924122913 1:240820731-240820753 ATCTGCTGGTGCCTTGATCTTGG + Intronic
924159611 1:241217286-241217308 ATTTTCTGGCTCCTTGATTATGG + Intronic
924163390 1:241257188-241257210 ATCTGCTGGCACCTTGATCTCGG - Intronic
924200068 1:241649340-241649362 ATCTGCTGGAGCCTTGATTTTGG + Intronic
1063023880 10:2158191-2158213 ATCTGCTGGCACTTTGATTTTGG + Intergenic
1063802937 10:9602266-9602288 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1064347897 10:14549112-14549134 ATCTGCTGGCACCTTGATCTAGG + Intronic
1064350409 10:14571051-14571073 ATCTGCTGGCACCTTGATCTTGG - Intronic
1064937719 10:20697186-20697208 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1065060388 10:21894943-21894965 ACTTGCTGGTATCTTGATCTTGG + Intronic
1065404158 10:25344849-25344871 ATCTGCTGGCACCTTGATATTGG - Intronic
1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG + Intergenic
1065921252 10:30394825-30394847 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1065966823 10:30777479-30777501 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1066019517 10:31283956-31283978 ATCTGCTGGTCCCTTGATCATGG + Intergenic
1066020093 10:31289795-31289817 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1066319191 10:34283270-34283292 AGTTTCTGGTACCTTGATGAAGG - Intronic
1066479455 10:35781451-35781473 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1066533689 10:36367058-36367080 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1066573310 10:36797420-36797442 ATCTGCTGGCACCTTGATTTTGG - Intergenic
1066578221 10:36849997-36850019 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1067799586 10:49349847-49349869 ATTTCCTGGGACCTTGACTGAGG + Intergenic
1067982412 10:51101352-51101374 ATTGGCTGGCACCTTGATCTTGG + Intronic
1068194511 10:53698699-53698721 ATTAACTGGTTCTTTGATTCAGG + Intergenic
1068348062 10:55809873-55809895 ATTTGCTGACCCCTTGATTGTGG + Intergenic
1068510401 10:57958324-57958346 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1068660043 10:59614364-59614386 ATCTGCTGGCACCTTGATTTTGG - Intergenic
1069807546 10:71135472-71135494 ATTTGCTGGTACCTTGATCTTGG - Intergenic
1069946537 10:71990241-71990263 ATCTGCTGGCTCCTTGATTTTGG - Intronic
1070020377 10:72579272-72579294 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1070367924 10:75753933-75753955 ATTTGCTGGTGCATTGACTGTGG + Intronic
1070706687 10:78644731-78644753 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1070872420 10:79768321-79768343 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
1070988507 10:80710036-80710058 ACTTGCTGGCTCCTTGCTTCTGG + Intergenic
1071198584 10:83191096-83191118 ATTTGCTGGCACCTTGATCCTGG - Intergenic
1071349075 10:84721252-84721274 ATCTGCTGGCACTTTGATCCTGG + Intergenic
1071474362 10:86012804-86012826 ATCTGCTGGGACCTTGATCTTGG + Intronic
1071639341 10:87290473-87290495 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
1071655896 10:87447476-87447498 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
1071692697 10:87838830-87838852 ATCAGCTGGCACCTTGATTCGGG + Intronic
1071791266 10:88956854-88956876 AGATGCTGGCACCTTGATCCTGG - Intronic
1072057169 10:91771159-91771181 ATGTGCTGGTACCTTGATCTTGG - Intergenic
1072897565 10:99379905-99379927 ATCTGCTGGCACCTTGATATTGG - Intronic
1073040466 10:100600914-100600936 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1073470476 10:103719050-103719072 ATCTGCTGGTGCCTTGGTTTAGG + Intronic
1073569655 10:104566981-104567003 ATTTGCTGGCACCTGGATTTTGG + Intergenic
1073617747 10:105014889-105014911 ATCTGCTGGTATCTTGATCTGGG + Intronic
1073703735 10:105959027-105959049 ATCTACTGGTACCTTGATCTTGG + Intergenic
1073998399 10:109342077-109342099 CTTTGCTGGTACCTTGATCTTGG + Intergenic
1074146236 10:110719937-110719959 ATTTGCTGGTGCCTTGATCTTGG - Intronic
1074148395 10:110737309-110737331 ATCTGCTGGTGCCTTGATTGTGG + Intronic
1074258528 10:111828481-111828503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074600414 10:114908141-114908163 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1074726958 10:116320861-116320883 ATTCGCTGGCACCTTGATCTTGG + Intergenic
1074744269 10:116515579-116515601 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1074754515 10:116614572-116614594 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1075142027 10:119846840-119846862 ATCTGCTGGGAACTTGATTTTGG + Intronic
1075156835 10:119984813-119984835 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1075196408 10:120363077-120363099 ATCTGCCAGTACCTTGATTTTGG + Intergenic
1075570430 10:123538002-123538024 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1075815249 10:125260064-125260086 AGATGCTGGTACCTTGATGATGG - Intergenic
1075987431 10:126799850-126799872 ATTTGCTGGTACCTTGATATAGG - Intergenic
1076004576 10:126938657-126938679 ATTTGCTAGTGCCTTGATCTTGG - Intronic
1076038141 10:127218831-127218853 ACTTGCTGGTGCCTTGATTTTGG - Intronic
1076060082 10:127407284-127407306 ATCTGCTGGCACCTTGATCTTGG - Intronic
1076382522 10:130035179-130035201 ATCTGCTGATACCTTGATCTTGG - Intergenic
1077713258 11:4556724-4556746 TATTGCGGGTACCTTGAGTCTGG - Intergenic
1077817613 11:5701709-5701731 GGTTGCTGGTACATTGATTTTGG - Intronic
1077869963 11:6253509-6253531 ATGTGTTGGTACCTTGATCTGGG - Intergenic
1077956607 11:7027329-7027351 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078005671 11:7530603-7530625 CTCTGCTGGTGCCTTGATCCTGG + Intronic
1078194471 11:9123995-9124017 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1078467669 11:11562180-11562202 TCTTGCTGGCACCTTGATTGCGG - Intronic
1078571331 11:12460571-12460593 ATTTGCTGGTGAGTTAATTCTGG - Intronic
1078734742 11:14009714-14009736 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078889554 11:15542197-15542219 AATTTCTGGTAGCTGGATTCTGG - Intergenic
1078908944 11:15713139-15713161 ATTGGCTGGCACCTTGATCTTGG - Intergenic
1078931646 11:15916742-15916764 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1078992219 11:16660826-16660848 ATATGCTAGTGCCTTGATCCTGG + Intronic
1079045461 11:17098442-17098464 ATTGGCTGGCACCTTGATTTTGG + Intronic
1079147817 11:17869492-17869514 ATCAGCTGGTACCTTGATCTTGG - Intronic
1079611329 11:22436127-22436149 ATCTGCTGGTGCTTTGATCCTGG - Intergenic
1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1079969150 11:27015379-27015401 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1080205624 11:29725674-29725696 ACATGCTGGTGCCTTGATTTTGG + Intergenic
1080351749 11:31393018-31393040 ATCTGCTAGTGCCTTGATTCAGG + Intronic
1080585251 11:33675864-33675886 ATCTGCTGGTACCTTGAATTTGG + Intergenic
1080593037 11:33740122-33740144 ATTTGCTGATGCCTTGATCTTGG + Intergenic
1080630815 11:34073919-34073941 AGATGCTGGTACCTTGATCTTGG - Intronic
1080766317 11:35300573-35300595 ATCTGCTAGTACCTTGATCTTGG + Intronic
1080878500 11:36298075-36298097 AGTTGCTGGTCCCTTGAAGCTGG + Intronic
1080942366 11:36933897-36933919 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1081232764 11:40606303-40606325 ATTAGCTGGTTTCTTCATTCAGG - Intronic
1081848268 11:46256830-46256852 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1082669243 11:56014103-56014125 ATCTGCTGGTTCTTTGATCCTGG - Intergenic
1082740232 11:56902699-56902721 ATTTGCTGGTTCATTGTTTTGGG + Intergenic
1082998159 11:59268920-59268942 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1083055897 11:59819345-59819367 ATCTGCTGTTCCCTTGATGCAGG - Intergenic
1083145147 11:60752604-60752626 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1083538436 11:63492636-63492658 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1083587204 11:63869043-63869065 ATTTTCTTCTTCCTTGATTCTGG + Intronic
1083792242 11:64993505-64993527 ATTGGCTGGCACCTTGATCTTGG + Intronic
1084355097 11:68633274-68633296 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1084673428 11:70620868-70620890 AATTGCTGGCACCTTGATCTGGG + Intronic
1085007170 11:73102759-73102781 AGATGCTGGTGCCTTGATTTTGG + Intronic
1085074563 11:73578979-73579001 ATCTGCTAGTACCTTGATCTTGG - Intronic
1085654111 11:78296845-78296867 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1085730937 11:78998038-78998060 ATCTGCTGGCACCTTGATCTTGG + Intronic
1085773925 11:79348689-79348711 ATTGGCTGGCACCTTGATCTTGG + Intronic
1085846467 11:80071468-80071490 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1085877148 11:80422375-80422397 ATCTGCTGGTGCCTTGATTATGG - Intergenic
1085908087 11:80788746-80788768 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1086060853 11:82698542-82698564 ACCTGCTGGTGCCTTGATCCTGG + Intergenic
1086140467 11:83493138-83493160 ATTTCCTTGAATCTTGATTCAGG + Intronic
1086621800 11:88894913-88894935 ATTTGCTGCCACCTTGATCTTGG + Intronic
1086744726 11:90410776-90410798 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1086942616 11:92814093-92814115 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1087002864 11:93438978-93439000 ATTAGCTGGCACCTTGATCTTGG - Intergenic
1087004024 11:93451038-93451060 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087022118 11:93614262-93614284 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087086534 11:94224903-94224925 CTTGCCTGGTACCTTGATTTTGG - Intergenic
1087160756 11:94946012-94946034 AGATGTTGGTACCTTGATTTTGG - Intergenic
1087186550 11:95204709-95204731 ATTTGCTGGCACCCTGATCTAGG + Intronic
1087215502 11:95488716-95488738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1087336221 11:96848035-96848057 ATCTGCTGGTAACTTGATCATGG + Intergenic
1087558394 11:99752016-99752038 ATCCACTGGTACCTTGATTTTGG + Intronic
1087603464 11:100345174-100345196 ATTTGCTGGAGCCTTGATCTTGG - Intronic
1087612307 11:100448979-100449001 ATCTGCTGGAACCTTGATCTTGG + Intergenic
1087840465 11:102915470-102915492 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1087967224 11:104431780-104431802 ATTTGTTGGTACTATAATTCCGG + Intergenic
1088025993 11:105183966-105183988 CTTTGCTGACACCTTGATTTTGG + Intergenic
1088105636 11:106203919-106203941 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1088361021 11:108990112-108990134 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1088489966 11:110377523-110377545 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1088571556 11:111228336-111228358 AAATGCTGGTGCCTTGATTTTGG - Intergenic
1088731304 11:112685906-112685928 AGGTGCTGGCACCTTGATCCTGG + Intergenic
1089668855 11:120038179-120038201 ATTGGCTGGCACCTTGATCTTGG + Intergenic
1089944149 11:122450338-122450360 ATTTGCTGGCACTTTGAATCTGG + Intergenic
1090093488 11:123721542-123721564 TTTTGCTGGTTTCTTGACTCAGG + Intergenic
1090374466 11:126279207-126279229 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1090651879 11:128814183-128814205 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1091198062 11:133748717-133748739 ATCTGCTGGCAACTTGATTTTGG - Intergenic
1091414916 12:273536-273558 CTTTGCTGGTACCCTGCTTCAGG - Intergenic
1091521575 12:1249779-1249801 ATCTGCTGGTTCCTTGATCTTGG - Intronic
1091619826 12:2078256-2078278 ATCTGCTGGCACCTTGATCTTGG + Intronic
1091637151 12:2205797-2205819 ATCTGCTGGCACCTTGATCCTGG - Intronic
1091756101 12:3052820-3052842 ATTTGCTGGAACCTTGATCTTGG + Intergenic
1091862554 12:3799178-3799200 ATCTGCAGGCACCTTGATTTGGG + Intronic
1091977697 12:4838701-4838723 ATTTGCTGACACCTTGATGACGG - Intronic
1092128954 12:6095132-6095154 GAATGCTGGTACCTTGATTTTGG + Intronic
1092318739 12:7447977-7447999 ATTTGCTGGCACCTTGAACATGG + Intronic
1092353831 12:7778114-7778136 ATTTGCTGGAGCCTTGATCTTGG + Intergenic
1092365861 12:7876405-7876427 ATTTGCTGGGGCCTTGATCTTGG + Intronic
1092395100 12:8118979-8119001 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1092907208 12:13112218-13112240 TTCTGCTGATACCTTGATTTTGG + Intronic
1092932712 12:13331989-13332011 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1093214140 12:16343337-16343359 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1093378057 12:18455612-18455634 ATCTGCTGGTACCTTGATCTTGG - Intronic
1093480860 12:19602458-19602480 ATCTGCTGGCAACTTGATCCTGG + Intronic
1093770661 12:23013935-23013957 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1093823629 12:23653605-23653627 ATTTGCTGGTGCCCTTATTTTGG - Intronic
1094254260 12:28403396-28403418 ATCTGCAGGTACCTTGATCTTGG - Intronic
1094342398 12:29427607-29427629 ATCTGCTGGCACCTGGATCCTGG + Exonic
1094410200 12:30160282-30160304 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1094793906 12:33948543-33948565 AGTTACTAGTACCTTGATTTTGG - Intergenic
1095105179 12:38225424-38225446 AGTTACTAGTACCTTGATTTTGG - Intergenic
1095384001 12:41628721-41628743 ATCTGCCAATACCTTGATTCTGG + Intergenic
1095408474 12:41894622-41894644 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1095453853 12:42361272-42361294 ATCTGCTGGTACCTTGATCTTGG + Intronic
1095526190 12:43128793-43128815 ATTTGTTAGAACCTTTATTCTGG + Intergenic
1095671530 12:44866167-44866189 ATCTGCTGGCACCTTGATCTTGG + Intronic
1095775154 12:46002451-46002473 ATTTGCTTGTACCTTGATCTTGG + Intergenic
1095930339 12:47619238-47619260 ATCTGCTGGCATCTTGATCCTGG + Intergenic
1096266034 12:50123382-50123404 ATCTGCTGGCAACTTGATCCTGG - Intergenic
1096425603 12:51499764-51499786 ATTTGCTTCTCACTTGATTCAGG - Intronic
1096932738 12:55232374-55232396 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1097306331 12:58073117-58073139 ATCTGCTAGTGCCTTGATTTTGG + Intergenic
1097325537 12:58272320-58272342 ACTGGCTGGTACCTTGATCTTGG - Intergenic
1097786756 12:63768899-63768921 ATCTGCTGTTACCTTGATCTTGG - Intergenic
1098031747 12:66261796-66261818 ATCTGCTGGTGCCTTGGTTGTGG + Intergenic
1098084778 12:66830546-66830568 CTGTGCTGATACCTTGATTTTGG + Intergenic
1098327070 12:69313908-69313930 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1098448711 12:70594649-70594671 ATTTCCTGGTCCCATGGTTCTGG - Exonic
1098527024 12:71498402-71498424 ATCTGCTGGTACCTTGATCTTGG - Intronic
1098888018 12:75979918-75979940 ATTTGTTGCTACAGTGATTCTGG + Intergenic
1099072728 12:78066192-78066214 ATCTGCTGGCACCTTGATAAAGG + Intronic
1099120769 12:78686736-78686758 ATCTGCTGGTACCTTCACCCTGG - Intergenic
1099207384 12:79744042-79744064 ATTTGCTAGTGCCTTGATCTTGG + Intergenic
1099303016 12:80921230-80921252 ATATGCTGGTACCTTGATTTTGG + Intronic
1099432506 12:82604651-82604673 ACTGGCTGGTACCTTGATCTTGG + Intergenic
1099482301 12:83183174-83183196 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1099652062 12:85441313-85441335 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1099662991 12:85589561-85589583 ATTTGTTGGCACCTTGATCTTGG + Intergenic
1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG + Intergenic
1100222557 12:92521637-92521659 ATCTGCTGGCACCTTGATTGTGG + Intergenic
1100267411 12:92990628-92990650 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1100343951 12:93708881-93708903 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1101042740 12:100773098-100773120 ATCTGCTGGTACCTTGATCATGG - Intronic
1101114566 12:101519463-101519485 ATTGGCTGGCACCTTGATCTTGG - Intergenic
1101317504 12:103643063-103643085 AACTACTGGTACCTTGATTTTGG - Intronic
1101437089 12:104672987-104673009 CTTTGCTGACACCTTGATTTTGG - Intronic
1101691719 12:107088585-107088607 ATCTGCTGGTGCCTTGATTCTGG + Intronic
1101722473 12:107362025-107362047 ATCTGCTGGCACCTTGATCTTGG + Intronic
1101733104 12:107442907-107442929 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1101734584 12:107453528-107453550 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1101762814 12:107672986-107673008 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1102407282 12:112684850-112684872 ATCTGCTGGCACCTTGATCTTGG - Intronic
1102982262 12:117251204-117251226 ATCTGCTGGCACCTTGATCTTGG + Intronic
1103014228 12:117481534-117481556 ATTTGCCAGCACCTTGATTTTGG + Intronic
1103171572 12:118824995-118825017 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1103448347 12:121009665-121009687 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1104310535 12:127650859-127650881 ATCTGCTGGTTCCTTGATCTTGG - Intergenic
1104695616 12:130861397-130861419 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1105936188 13:25101754-25101776 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1106096117 13:26645323-26645345 ATCTGCTGGCACCTTGACTTTGG + Intronic
1106130259 13:26933778-26933800 GTCTGCTGGTACCTTGATCTTGG + Intergenic
1106501430 13:30332592-30332614 ATTTACTGGCACCTTGATATTGG + Intergenic
1106537843 13:30663549-30663571 ATGTGCTGATACCTTGATCTTGG - Intergenic
1106654577 13:31728980-31729002 ATTTGCTGGTATTGTGATTGGGG - Intergenic
1106820368 13:33457643-33457665 TTCTGCTGGCACCTTGATCCTGG - Intergenic
1107376674 13:39811467-39811489 ATTGGCTGGCACCTTGATCTTGG - Intergenic
1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG + Intronic
1108057016 13:46495226-46495248 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1108156824 13:47593632-47593654 ACCTGCTGGAACCTTGATTTTGG - Intergenic
1108440096 13:50443506-50443528 ATCTGCAGGCACCTTGATGCTGG + Intronic
1108477844 13:50838944-50838966 ATTTGTTGGCACCATGATTTTGG + Intronic
1108975964 13:56443564-56443586 ATCTGCTGGAACCTTGATCTTGG - Intergenic
1108984908 13:56574790-56574812 ATTTGCTGGTGCATTGATCTTGG - Intergenic
1109085523 13:57966407-57966429 ATCTGCTGATACCTTGATTTTGG + Intergenic
1109233530 13:59787963-59787985 ATCTGCTGGCATCTTGATTTTGG + Intronic
1109330216 13:60919823-60919845 AGATGCTGGTACCTTGATCTTGG - Intergenic
1109616016 13:64834824-64834846 ACTGTCTGGTACCTTGATTTTGG + Intergenic
1109658494 13:65427341-65427363 ACTTGCTAGCACCTTGATTTTGG - Intergenic
1109682796 13:65774625-65774647 ATATGCTGGCACCTTGATCTTGG + Intergenic
1109977781 13:69862843-69862865 ATTTGCAGGCACCTTGATCTTGG + Intronic
1110058267 13:71005956-71005978 ATCTACTGGTACCTTGATCTTGG - Intergenic
1110315950 13:74107024-74107046 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1110351625 13:74515279-74515301 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1110666598 13:78124774-78124796 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1110677083 13:78261518-78261540 ATTTTCTGGCACCTTGATCTTGG + Intergenic
1110707532 13:78612198-78612220 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1110744694 13:79038864-79038886 ATCTGCTGGCACCTTGATGTTGG - Intergenic
1110753042 13:79137680-79137702 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1110832287 13:80045180-80045202 ATTGGCTGGCACCTTGATCGTGG + Intergenic
1110887761 13:80659240-80659262 ACTTGCTGGCTCCTTGCTTCTGG - Intergenic
1111063052 13:83048747-83048769 ATTTTCTTCTAACTTGATTCTGG - Intergenic
1111258495 13:85704227-85704249 ATTTGATGGTACCTTGATCCTGG + Intergenic
1111261624 13:85748006-85748028 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1111361395 13:87182332-87182354 ATCTGCTGGTACCTTTATCTTGG + Intergenic
1111497444 13:89070692-89070714 ATCTGCTGGGACCTTGATTGTGG + Intergenic
1111720311 13:91935496-91935518 ATCTGCTGGTACCTTGAGTTTGG + Intronic
1111816644 13:93162429-93162451 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1111883478 13:93988530-93988552 ATGTGCTGGCACCTTGATCTTGG - Intronic
1112034412 13:95484052-95484074 ATTTGCTGGTGCCTTGACTTTGG + Intronic
1112207287 13:97337246-97337268 ATCTGCGGGCACCTTGATTTGGG + Intronic
1112231916 13:97596389-97596411 ATCAACTGGTACCTTGATGCTGG - Intergenic
1112253531 13:97806516-97806538 ATTAGCTGGTCCCTTTATTTAGG - Intergenic
1112288271 13:98123215-98123237 ATCTGCTGGCACCTTGATCATGG - Intergenic
1112414577 13:99193625-99193647 CTTTGCTGGTGCCTTGATCTTGG - Intergenic
1112606748 13:100913783-100913805 ATTGGCTGGCACCTTGATCTTGG + Intergenic
1112732548 13:102381516-102381538 ATTTGCTGGTGCATTGATCTTGG + Intronic
1113031616 13:105999634-105999656 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1113044644 13:106142276-106142298 ATCTGCTGGCACCTTGATTTTGG + Intergenic
1113090648 13:106614384-106614406 ATTTACTGGCACCTTGATCTTGG + Intergenic
1113233939 13:108248307-108248329 ATTTGTTGGCACCTTGATCATGG - Intergenic
1113273512 13:108701507-108701529 ATATGCTGGCCCCTTGATTTTGG + Intronic
1113359108 13:109612026-109612048 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1113492583 13:110704051-110704073 ATTTGCTGGTGCCTTCATCTTGG + Intronic
1113631426 13:111888208-111888230 ATTTGCTTGTATCTTGAAACAGG + Intergenic
1113737192 13:112687473-112687495 ATCTGCTGGGACCTTGATCTTGG - Intergenic
1113916928 13:113879793-113879815 CCTTGCTGGCACCTTGATTTTGG - Intergenic
1114882526 14:26804460-26804482 ATTGGCTGATACTTTGATTTTGG + Intergenic
1115143102 14:30196602-30196624 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1115658417 14:35466269-35466291 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1115708922 14:36028442-36028464 ATTGGCTGGTGCCTTGATCTTGG + Intergenic
1115986120 14:39104843-39104865 ATCTGCTGGCATCTTGATCCTGG - Intronic
1116721214 14:48498203-48498225 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1116752533 14:48904462-48904484 ACTTGCTGGCACCTTGATGTTGG + Intergenic
1116786061 14:49289920-49289942 ACCTGCTGGTACCTTGATCTTGG + Intergenic
1116837702 14:49787341-49787363 ATCTGCTGGTGCCTTGATGCTGG - Intronic
1117058066 14:51933100-51933122 CTCTGCTGGCACCTTGATTTTGG + Intronic
1117160625 14:52986106-52986128 ATCTGCTGGCACCTTGATCCTGG - Intergenic
1117202535 14:53406875-53406897 GCTTGCTGGTACCTTGATCTTGG + Intergenic
1117224386 14:53639576-53639598 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1117518460 14:56526182-56526204 CTCTGCTGGCACCTTGATTTTGG + Intronic
1117748643 14:58897921-58897943 ATTTACTGGTGCCTTGATTTTGG - Intergenic
1118033317 14:61839332-61839354 AGATGCTGGTACCTTGATCTTGG + Intergenic
1118072538 14:62261500-62261522 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1118328761 14:64800003-64800025 ATTTCGTGGCACCTTGATTGTGG - Intronic
1118437841 14:65787663-65787685 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1118546562 14:66895978-66896000 ATCTGCGGGCACCTTGATTGTGG - Intronic
1118568389 14:67168127-67168149 CCTTGCTGGCACCTTGATTTTGG - Intronic
1118591104 14:67401647-67401669 AACTGCTGGTACCTTGATATTGG + Intronic
1119001708 14:70888045-70888067 ATCTGCTGGCACCTTGATTTTGG - Intergenic
1119181343 14:72607308-72607330 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1119298026 14:73549077-73549099 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1119863351 14:77953182-77953204 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1119894705 14:78210194-78210216 ATCTGCTGGCAACTTGATCCTGG - Intergenic
1119911459 14:78353363-78353385 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1120346026 14:83291386-83291408 ATTTTCTTTTATCTTGATTCTGG + Intergenic
1120398241 14:83995481-83995503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120579464 14:86228067-86228089 ATCTGCTGGCACCTTGATCCTGG + Intergenic
1120595010 14:86422685-86422707 ATTTGCTGGCATCTTGATCTTGG - Intergenic
1120692525 14:87608140-87608162 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1120720315 14:87883179-87883201 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1120842182 14:89095634-89095656 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120855223 14:89206071-89206093 ATCTGCTGGCACCTTGATTTTGG + Intronic
1120916453 14:89714879-89714901 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1121081356 14:91111138-91111160 ATCTACTGGCACCTTGATCCTGG - Intronic
1122039989 14:98980352-98980374 ATCTGCTGGTACCTTGATATTGG + Intergenic
1122725883 14:103751757-103751779 ATTTGCTGGCACCTTGATCTTGG + Intronic
1123767843 15:23499510-23499532 ACTTGCTGGCACCTTGATTTTGG + Intergenic
1123853781 15:24385726-24385748 ACTAGCTGGTCCCTTGATTGGGG - Intergenic
1123963762 15:25435654-25435676 ATTTGTTGGTACCTTGATCTTGG + Intronic
1124046773 15:26157809-26157831 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1124047385 15:26162791-26162813 ATCTGCTGGCACCTTGATCTAGG - Intergenic
1124101817 15:26702929-26702951 ATTTGCTGGAGACTTGATTTTGG - Intronic
1124149998 15:27168764-27168786 ATCTGCTGGTATCTTGATCTTGG + Intronic
1124570435 15:30858055-30858077 ACTTGGTGGCACCTTGATTTTGG - Intergenic
1124592882 15:31068867-31068889 ATCTGCTGGCACCTTGATCTTGG + Intronic
1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG + Intergenic
1125154321 15:36568930-36568952 ATTTGCTGGCTCCTTGATCTTGG + Intergenic
1125347634 15:38734188-38734210 ATTGGCTGGCACCTTGATCTTGG - Intergenic
1125987383 15:44067512-44067534 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1126262219 15:46706468-46706490 ATCTGTTGGCACCTTGATTTTGG + Intergenic
1126320562 15:47418416-47418438 ATTTGCTGATGCCTTGATCTTGG - Intronic
1126386481 15:48098899-48098921 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1126594173 15:50369127-50369149 ATTGGCTGGCACCTTGATCTTGG + Intergenic
1126597944 15:50400389-50400411 ACTTGCTGGCACCTTGATCTTGG + Intergenic
1126642228 15:50839925-50839947 ATTTGCTGGCACTTTGATATTGG - Intergenic
1127046983 15:55036306-55036328 ATCCGCTGGCACCTTGATTTTGG + Intergenic
1127057012 15:55142435-55142457 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1127346216 15:58102409-58102431 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1127686763 15:61353370-61353392 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1127726297 15:61753430-61753452 ATTGGCTGGCACCTTGACTTTGG - Intergenic
1127733239 15:61819140-61819162 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1127967191 15:63931185-63931207 ATTTGCTGGCACCTTGACCTTGG + Intronic
1129370394 15:75089974-75089996 ATCTGCTGGTGCCCTGATTTTGG - Intronic
1129820226 15:78595927-78595949 ATTTGCTGGTGCCTTGACCTTGG + Exonic
1129995834 15:80004269-80004291 CTTGGCTGGTACCTGGATGCAGG - Intergenic
1130031462 15:80318177-80318199 ATCTGCTGGTACTTTGATCTAGG - Intergenic
1130035274 15:80354710-80354732 CCTTGCTGACACCTTGATTCTGG + Intronic
1130511148 15:84590299-84590321 ACCTGCTGGTACCTTGATCTTGG + Intergenic
1130921135 15:88345615-88345637 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1131085107 15:89569457-89569479 GTCTGCTGGTGCCTTGATCCTGG - Intergenic
1131473967 15:92720370-92720392 ATCTGCTGGCACCTTGATCTTGG + Intronic
1131533212 15:93212336-93212358 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1131592344 15:93763215-93763237 ATTGGCTGGCACCTTGATCTTGG - Intergenic
1131720756 15:95166074-95166096 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1131740867 15:95389826-95389848 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1132132369 15:99294554-99294576 ATCTGCTGGCACCTTGATCTTGG - Intronic
1133475561 16:6118391-6118413 ATCTGCTGGTGCTTTGATTTTGG - Intronic
1133907833 16:10038118-10038140 ATATGCTGGCACCTTGATCTTGG - Intronic
1134195244 16:12154718-12154740 ATCTGCTGGCACCTTGATCTTGG - Intronic
1134437020 16:14268994-14269016 ATCTGCTGGAACCTTGATGTTGG - Intergenic
1134867783 16:17624048-17624070 ATTAGCTGGCACCTTGATCTTGG + Intergenic
1134894296 16:17870935-17870957 ATCTGCTGGCACCTTGATATTGG - Intergenic
1135018485 16:18944041-18944063 ATCTACTGGTGCCTTGATTTTGG + Intergenic
1135059879 16:19262384-19262406 ATCTGCTGGTACCTTGATCTGGG + Intronic
1135069033 16:19336218-19336240 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1135097654 16:19577872-19577894 ATCTGCTGGGACCTTGATCTTGG + Intronic
1135279689 16:21143459-21143481 ATCTGTTGGTACCTTGATCTCGG + Intronic
1135833555 16:25800897-25800919 ATTTGCTGGCACCTTGATCTTGG + Intronic
1135835549 16:25822220-25822242 ATCTGCTGGCACCTTGATCTTGG - Intronic
1136603829 16:31317514-31317536 ATCTGCTTGCACCTTGATTTTGG + Intronic
1137292776 16:47063189-47063211 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137384219 16:48026723-48026745 AAATGCTGGTACCTTGATCTTGG - Intergenic
1137593729 16:49709824-49709846 ATCTCCTGGCACCTTGATTTTGG + Intronic
1137699374 16:50485438-50485460 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1138239141 16:55412364-55412386 AACTGCTGATACCTTGATTTTGG + Intronic
1138304274 16:55960042-55960064 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1138341409 16:56291750-56291772 ATCTGCTGGTATCTTGATGTTGG - Intronic
1138791507 16:59909118-59909140 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1138793545 16:59939428-59939450 ATCTGCTGGCTCCTTGATCCTGG + Intergenic
1139145881 16:64325078-64325100 ATCTGCTGGTGCTTTTATTCAGG - Intergenic
1139277847 16:65744380-65744402 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1139389078 16:66594307-66594329 ATTTGCTGGCATCTTGATCATGG + Intergenic
1139438708 16:66952823-66952845 ATCTGCTGACACCTTGATCCTGG - Intergenic
1139950864 16:70668816-70668838 ATCTGCTGGTGTCTTGATCCTGG + Intronic
1140008060 16:71099416-71099438 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1140048513 16:71458771-71458793 ATCAGCTGGCACCTTGATCCTGG + Intronic
1140596611 16:76423112-76423134 ATCTGCTGGTGCCTTCATTTTGG + Intronic
1140694018 16:77514003-77514025 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1140835995 16:78794255-78794277 ATTTGCTGCTTCCTTGATCTTGG + Intronic
1141711697 16:85703304-85703326 ATGTGCTGGCACCTTGATCTTGG + Intronic
1141936021 16:87238335-87238357 ATCTGCTGGCACCTTGATCTTGG - Intronic
1142004400 16:87682597-87682619 ATCTGCTGGCACCTTGATCTTGG + Intronic
1143193731 17:5059562-5059584 ATTGGGTGGAACCTTGATACTGG - Intergenic
1143919353 17:10318507-10318529 ATTTGCTGGCACTTTGATCTTGG + Intronic
1143991506 17:10967273-10967295 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1144001961 17:11063630-11063652 ATCTGCTGGCACCTTGATCCTGG - Intergenic
1144028900 17:11302422-11302444 ATGTCCTGGGACCTGGATTCTGG - Intronic
1144043760 17:11436267-11436289 CTTTGCTGGTATCTTGATCTTGG + Intronic
1144124426 17:12189457-12189479 ACCTGCTGGCACCTTGATTTTGG - Intergenic
1144286273 17:13777788-13777810 CTTTGCTGGTGCCTGGCTTCTGG - Intergenic
1144287307 17:13789384-13789406 GTTTGCTGGTACCTTGATCTTGG + Intergenic
1144304160 17:13952183-13952205 CTTTGCTGGTAACATGACTCGGG + Intergenic
1144938144 17:18916742-18916764 ATCTGCTGGTGCCTTGATCCAGG - Intronic
1145187538 17:20808105-20808127 ATATGCTATTACCTTGATTTTGG + Intergenic
1146098110 17:29952058-29952080 ACTTGCTGGTGCCTTGATCTTGG - Intronic
1146180034 17:30692084-30692106 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1146185918 17:30724155-30724177 ATTCGCTGGCACCTTGATCTTGG + Intergenic
1146460892 17:33045387-33045409 ATTTGCTGGGAACATGCTTCCGG - Intronic
1146511657 17:33454733-33454755 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1146567687 17:33927543-33927565 ATCTGCTGCTGCCTTGATCCTGG + Intronic
1146580080 17:34029756-34029778 ATCTGCTGGCACCTTGATTTTGG + Intronic
1146928173 17:36759258-36759280 ATTTGCCGGTGCCTTGATCTTGG + Intergenic
1147517210 17:41131390-41131412 ATTCTTTGGTACCTTGATTGGGG + Intergenic
1148537648 17:48454131-48454153 ATCTGCTGGTACGTTGATCTTGG - Intergenic
1149182179 17:53952423-53952445 ATTTGCTGTTACTTTGATGGGGG - Intergenic
1149360009 17:55885193-55885215 ATTTGCTGGCACATTGATCTTGG + Intergenic
1149619664 17:58033953-58033975 ATCTGCTGGCATCTTGATACTGG + Intergenic
1149888415 17:60364087-60364109 ATCTGCTGGTACTTTGATCTTGG - Intronic
1150166471 17:62948288-62948310 ATCTGCTGGCACCTTGATTTTGG + Intergenic
1150188660 17:63214543-63214565 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1150583899 17:66500184-66500206 ATCTGCTGGCACCTTGATCTTGG + Intronic
1150767544 17:68014200-68014222 TTTGTCTGGAACCTTGATTCAGG + Intergenic
1151889048 17:76941450-76941472 CTTGGCTGGTTCCTTCATTCTGG + Intronic
1153077688 18:1183917-1183939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1153519839 18:5941242-5941264 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1153664017 18:7352005-7352027 ATCCGCTGGTACCTTGATCTTGG + Intergenic
1153668996 18:7392460-7392482 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1153963141 18:10157080-10157102 AACTGCTGGCACCTTGATTTTGG + Intergenic
1154392021 18:13945749-13945771 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1155026954 18:21949703-21949725 ATCTGCTGCCACCTTGATTTTGG + Intergenic
1155109354 18:22698706-22698728 CTTTGCTGGTAAGTTTATTCAGG - Intergenic
1155198180 18:23494514-23494536 TTTAGCTGGTACCTTGATCTTGG - Intergenic
1155487041 18:26356118-26356140 ATCTGCTGGCACCTTGATCTTGG - Intronic
1155637652 18:27974835-27974857 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1156110457 18:33719819-33719841 ATCTGCTGGTACCTTAATCTTGG + Intronic
1156150517 18:34235863-34235885 AATTGCTGGAACCTTGAATATGG + Intergenic
1156245838 18:35297217-35297239 CTTTGCTGGTCCCTTGATTTGGG - Intergenic
1156309792 18:35911378-35911400 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1156481301 18:37438079-37438101 ATCTGCTAGCACCTTGATTTTGG + Intronic
1157301765 18:46484508-46484530 ATTTGCTGGTGCCTTGGTCCTGG + Intronic
1157517914 18:48324085-48324107 ATCTGCTGGCACCTTGATCTTGG + Intronic
1157663586 18:49466829-49466851 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1157869952 18:51220879-51220901 ATTGGCTGGTGCCTTGATCTTGG - Intergenic
1158494671 18:57943627-57943649 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1158702832 18:59764357-59764379 ATCTGCTGGCACCTTGATCCCGG - Intergenic
1158804082 18:60948139-60948161 ATCTGCTGGCACCTAGATTTTGG - Intergenic
1158920805 18:62188380-62188402 ATTTCCTGGTAGTGTGATTCAGG - Intronic
1158992790 18:62887486-62887508 ACCTGCTGGTGCCTTGATCCTGG - Intronic
1158999236 18:62956238-62956260 ATCTGCTGGTACCTTCATCTTGG - Intronic
1159007652 18:63026699-63026721 ATCTGCTGGCACCTTGATCTGGG + Intergenic
1159064584 18:63555817-63555839 ATCTGCTGATATCTTGATTTTGG + Intergenic
1159098024 18:63927454-63927476 ATCTCCTGGCACCTTGATTGCGG - Intronic
1159370503 18:67521811-67521833 ATCTTCTGGCACCTTGATCCTGG + Intergenic
1159618981 18:70615641-70615663 ATTTTCTGGTCCCTTTGTTCTGG + Intergenic
1162877951 19:13634841-13634863 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1162972858 19:14191574-14191596 ATTCGCTGGCACCTTGATCTTGG - Intronic
1163239742 19:16053508-16053530 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1163355003 19:16804662-16804684 AGTTGCTGGCACCTTGATCTTGG - Intronic
1163627975 19:18401814-18401836 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1165347500 19:35258011-35258033 ATCTCCTGGTACCTAGAATCTGG + Intronic
1167729421 19:51242654-51242676 ATCTGCTGGTCCCTTGATCTTGG - Intronic
1168490755 19:56806891-56806913 ATTTGCTGGCACCTTGATCTTGG + Intronic
925456582 2:4021604-4021626 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
925604179 2:5641353-5641375 ATCTGCTGGCACCTTGATCTTGG + Intergenic
925645237 2:6029238-6029260 ATTGGCTGGCACCTTGATCTTGG + Intergenic
926391095 2:12393615-12393637 ATCTGCTGGCACCTTGATCTTGG + Intergenic
926396454 2:12447452-12447474 ATCTGCTGGTTCCTTGATCTTGG + Intergenic
926582865 2:14650001-14650023 ATCTGCTGGCACCTTGATCTTGG + Intronic
926717556 2:15937126-15937148 AATTGCTGGCACCTTGATATTGG - Intergenic
926840371 2:17073141-17073163 ATCTGCTGGTACCTTGATCTTGG + Intergenic
927084673 2:19662694-19662716 ATGTGCTGGTACCTTGATCTTGG - Intergenic
927292987 2:21422671-21422693 ATCTGCTGGCACCTTGACTTTGG + Intergenic
927601922 2:24450529-24450551 ATCTGCTAGCACCTTGATCCTGG + Intergenic
927620570 2:24652986-24653008 ATTTGCTGATAGTATGATTCTGG - Intronic
927789136 2:25996445-25996467 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
928055955 2:28054675-28054697 AGTTGCTGCTACCTTGATCATGG + Intronic
928758358 2:34553063-34553085 ATTTGCTGGTACTTTTATCTTGG - Intergenic
929018932 2:37531030-37531052 ATTTGCTGATAACTTGATTTTGG + Intergenic
929072025 2:38040522-38040544 ATCTGCTGGTACATTGATCTTGG + Intronic
929335024 2:40732303-40732325 ATCTACTGGCACCTTGATTCTGG + Intergenic
929698953 2:44145262-44145284 ATTTGCTGGCACCTTGATCTTGG + Intergenic
929820577 2:45270327-45270349 ATTTGCTGGAAACTGGATACTGG - Intergenic
930107186 2:47649548-47649570 ATATGCTGGTGCCTTGATCTTGG + Intergenic
930140014 2:47942160-47942182 ATCTGCTGGCACCTTGATCTTGG - Intergenic
930394008 2:50796888-50796910 CTTTGCTGGTGCCTTGATCTTGG - Intronic
930673808 2:54178983-54179005 ATCTGCTGGCACCTTGATCTTGG - Intronic
931131871 2:59344955-59344977 ATTTACTGGCACCTTGATCTTGG + Intergenic
931140260 2:59449757-59449779 ATCTGCTGGTATCTTGATCTTGG + Intergenic
931332715 2:61304651-61304673 ATCTGCTGGCACCTTGATCTTGG + Intronic
931373228 2:61683507-61683529 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
931685492 2:64788843-64788865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
931726962 2:65120754-65120776 ATTTTCTGGTATCTTGATTTGGG - Intronic
931767670 2:65471176-65471198 ATCTTCTGGTACCTTGATCCTGG + Intergenic
932484124 2:72071219-72071241 ATCTGCTGATACCTTGATCTTGG - Intergenic
932525599 2:72463867-72463889 ATCTGCTGATACCTTGATGTTGG - Intronic
932634461 2:73376237-73376259 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
932689173 2:73897738-73897760 ATCTGCTGGTGCCTTGATCTTGG - Intronic
932776580 2:74531517-74531539 ACTTGCTGGTACTTTTGTTCGGG + Intronic
933290904 2:80437131-80437153 ATCTGCTGGTCCCTTGATCTTGG + Intronic
933320859 2:80773911-80773933 ATCTGCTGGCACCTTGATCTTGG + Intergenic
933562007 2:83899403-83899425 ATCTGCTGGTACCTTAATCTTGG + Intergenic
934774887 2:96930951-96930973 ATTTGCTGGTACCTTGATCTTGG + Intronic
934930073 2:98414975-98414997 ATCTGCTGGCACCTTGATCTTGG - Intergenic
935235308 2:101133523-101133545 ATCTGCTGGTGCCTTGATCTTGG - Intronic
935235426 2:101134515-101134537 ATTTGCTAGCCCCTTGATTTTGG - Intronic
935268684 2:101415380-101415402 ATCTGCTGGTGCCTTGATCTTGG + Intronic
935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG + Intronic
935670369 2:105550968-105550990 TTTTGCTAGCACCTTGATTTTGG + Intergenic
935697245 2:105780849-105780871 ATTTCCTGGTACTTTGATCTTGG + Intronic
935788514 2:106570356-106570378 ATCTGCTGGCACCTTGATCCTGG + Intergenic
935799751 2:106682588-106682610 ACCTGCTGGTACCTTGATCTTGG + Intergenic
935950331 2:108323103-108323125 GTCTGTTGGTACCTTGATTTTGG - Intergenic
936405471 2:112198762-112198784 ACCTGCTGGAACCTTGATCCTGG + Intergenic
936550172 2:113430917-113430939 ACTTCCTGGCACCTTGATTTTGG + Intergenic
936787033 2:116105940-116105962 ACTTGCTGGGACTTTGATCCTGG - Intergenic
936871432 2:117137707-117137729 ATTTGCTGATGCCTTGATCTTGG + Intergenic
936938030 2:117857114-117857136 ATCTGCTGGTAACTTGATCTTGG - Intergenic
937029734 2:118728464-118728486 ATCTGCTGGTACCTTGATCTTGG + Intergenic
937055394 2:118930802-118930824 ACTTGCTGGCACCTTGATCTTGG - Intergenic
937134361 2:119540188-119540210 ATGTGCTGGTGCCTTGATCTTGG + Intergenic
937282796 2:120731823-120731845 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937440986 2:121915918-121915940 ATCTGTTGGTACCTTGATCTTGG - Intergenic
937490801 2:122365388-122365410 ATGTGCCAGTGCCTTGATTCTGG - Intergenic
937496572 2:122426482-122426504 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
937589898 2:123600246-123600268 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937772129 2:125731907-125731929 ATTTGCTAGTGCCTTGATCTTGG - Intergenic
937795947 2:126020164-126020186 ATCTGCTGGCACCTTGATCTTGG + Intergenic
938038751 2:128058436-128058458 ATTTGCTAATGCCTTGATCCTGG + Intergenic
938598472 2:132812798-132812820 ATCTGCTGGCACCTTGATCTTGG - Intronic
938933792 2:136111175-136111197 ATTTGCTGGTGTCTTGATCTTGG - Intergenic
939105184 2:137940521-137940543 ATTTGCTGGTGCCTTCATCTTGG - Intergenic
939119558 2:138100302-138100324 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
939154341 2:138506452-138506474 AGTTGGTGGAACCTTGGTTCAGG + Intronic
939175897 2:138747004-138747026 ATTTGATGAAACCTTGATTTGGG - Intronic
939383763 2:141469455-141469477 ATCTGCTGGTACCTTGATCTTGG - Intronic
939430155 2:142093991-142094013 ATCTGCTGGCACCTTGATCTTGG - Intronic
939651115 2:144763045-144763067 ACCTGCTGGTACCTTGATCTTGG + Intergenic
939988205 2:148852998-148853020 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
940044196 2:149392019-149392041 ATTGGCTGGCACCTTGATCTTGG - Intronic
940069521 2:149669916-149669938 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
940322163 2:152389245-152389267 ATTTGCTGATGCCTTGATCTTGG - Intronic
940413444 2:153392999-153393021 ATCTGCTGGCACCTTGATCTTGG + Intergenic
940619000 2:156087189-156087211 ATTTGCTGGCACCTTGATTTTGG - Intergenic
941246886 2:163109567-163109589 ATCTGTTGGTGCCTTGATCCTGG - Intergenic
941349846 2:164418696-164418718 ATGTGCTGGTACCTTAATCTTGG - Intergenic
941666764 2:168250083-168250105 ATTTGCTGGCACCTTGATCTTGG + Intergenic
941709430 2:168696611-168696633 ATCTGCTGGTGCCTTGATCTGGG - Intronic
942122361 2:172790966-172790988 AGATGCTGGCACCTTGATACTGG - Intronic
942225006 2:173807413-173807435 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
942426889 2:175869478-175869500 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
942471617 2:176266767-176266789 ATCTGCTGGTGCCTTGATCATGG + Intergenic
942534642 2:176950182-176950204 ATCTGCTGGCACCTTGATCTTGG + Intergenic
942790811 2:179758294-179758316 ATCTGCTGATACCTTGATCTTGG - Intronic
942850734 2:180482391-180482413 ACCTGCTGGTACCTTGATAGTGG - Intergenic
942875895 2:180797100-180797122 ACTTGCTGGTACCTTCATCTTGG + Intergenic
943083547 2:183284643-183284665 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943451700 2:188050394-188050416 ATTTGCTGTCACCTTGATATTGG + Intergenic
943719474 2:191188843-191188865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
943781523 2:191829372-191829394 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943784377 2:191861041-191861063 ATTTGCTGGCACCTTGATCATGG - Intergenic
943818893 2:192293098-192293120 ATTTGCTGGCAGCTTGATCTTGG - Intergenic
943918989 2:193677787-193677809 ATATGCTGGCACCTTGATCTTGG + Intergenic
944214737 2:197243643-197243665 ATCTGCTGGCACCTTGATCTTGG - Intronic
944467357 2:200016799-200016821 ATTTGCTGGCACCTTGATCTTGG - Intergenic
945145470 2:206733543-206733565 ATCTGCTGGCACCTTGATCTTGG + Intergenic
945370362 2:209009017-209009039 ATCTGCTGGCACCTTGATCTTGG - Intergenic
945487103 2:210408897-210408919 ATCTGCTGGTATCTTGATCTAGG + Intergenic
945524748 2:210874389-210874411 ATCTGATGGTACCTTGATCTTGG - Intergenic
945607981 2:211960632-211960654 ATTTGCTGACACCTTGATATTGG - Intronic
945609660 2:211984079-211984101 ATCTGCTGGCACCTTGATCTTGG - Intronic
945765355 2:213969631-213969653 ATTTACTGGCACCTTGATCTTGG + Intronic
945884731 2:215363275-215363297 ATTTGCTGGGAAGTTGATTTTGG - Intronic
946480052 2:220046478-220046500 ATCTGCTGCTACCTTGACTTTGG + Intergenic
946499433 2:220230470-220230492 ATTTGCTAGCACCTTGATCTTGG + Intergenic
946521978 2:220475942-220475964 ATTTGCTGATACCTTGATCTTGG - Intergenic
946638803 2:221760637-221760659 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
947030652 2:225789151-225789173 ATCTGCTGGCACCTTGATCTTGG + Intergenic
947356679 2:229303316-229303338 ATTTGCTGACACCTTGATCTTGG - Intergenic
947844208 2:233231234-233231256 ACTTGCTGGTACCTTGATCTTGG - Intronic
947943921 2:234083451-234083473 ATCTGCTGGCACCTTGATGCTGG - Intergenic
947988335 2:234467397-234467419 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
948398279 2:237663518-237663540 ATCTGCTGGCACCTTGATCTTGG + Intronic
948408456 2:237740693-237740715 ATTTGCTGATACCTGAATGCAGG - Intronic
948512480 2:238478021-238478043 ATCTGCTAGTACCTTGATCTCGG + Intergenic
948658560 2:239492173-239492195 ACCTGCTGGCACCTTGATTTTGG - Intergenic
948875812 2:240827273-240827295 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1168864141 20:1070295-1070317 ATTTTGTGGCACCTTGATTTTGG + Intergenic
1169228879 20:3873714-3873736 ATCTGCTGGCACCTTGATCTTGG + Exonic
1169331387 20:4719229-4719251 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1169408502 20:5346962-5346984 ACTTGCTGGCACCTTGATCTTGG - Intergenic
1169741898 20:8903813-8903835 ATCTGCTGGCACCTGGATCCTGG + Intronic
1169770183 20:9191449-9191471 ATCTGCTGGTAACTTGATCTTGG + Intronic
1169830845 20:9823241-9823263 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1170460088 20:16569148-16569170 ATCTGCTGGCACCTTGATCTTGG + Intronic
1170552492 20:17489769-17489791 ATTTGCTGGCACCTTGATCTTGG - Intergenic
1171169160 20:23000218-23000240 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1172308165 20:33896579-33896601 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1172941063 20:38655053-38655075 ATTTTCTGGTACCTTGATCTTGG + Intergenic
1173010680 20:39178955-39178977 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1173057459 20:39629372-39629394 ATCTGCTGGCTCCTTGATTTTGG + Intergenic
1173157513 20:40627089-40627111 CTTTGCTGGCACCTTGATTTTGG - Intergenic
1173181699 20:40810935-40810957 ATCTGCTGGCATCTTGATCCTGG + Intergenic
1173334883 20:42104423-42104445 ATTTACTGGAAGCTTGATGCTGG + Intronic
1173395292 20:42673558-42673580 ATCTGCTGGCACCTTGATATTGG - Intronic
1173433013 20:43008353-43008375 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1173435827 20:43031428-43031450 ATCTGCTGGAACCTTGATCTTGG + Intronic
1173481146 20:43400454-43400476 GTTTGCTGGCACCTTGATTTTGG - Intergenic
1173707494 20:45123477-45123499 ATCTGCTGGTGCCTTGATCTTGG - Exonic
1174160554 20:48547403-48547425 ATTTGCTGGTGCCTCGATCTTGG - Intergenic
1174633570 20:51979472-51979494 CCTTGCTGATACCTTGATTTCGG + Intergenic
1174866287 20:54139335-54139357 ATTTGTTGGTGCCTTGATCTTGG - Intergenic
1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG + Intergenic
1175176496 20:57115476-57115498 ATCTGCTGGTGCCTTAATCCTGG - Intergenic
1175504573 20:59472515-59472537 CTTTGCTGGTCCCTGGATTGTGG - Intergenic
1176006886 20:62870192-62870214 ATATGCTGGTGCCTTGATCTGGG - Intergenic
1177007147 21:15687433-15687455 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1177201060 21:17956614-17956636 ATATGCTGGTGCCTTGATCTTGG - Intronic
1177203612 21:17985871-17985893 ATCTGCTGGTACCTTGATCTTGG - Intronic
1177285943 21:19049901-19049923 ACGTGCTGGTACCCTGATCCTGG + Intergenic
1177491038 21:21826287-21826309 ATATGCTGGCACCTTGATCTTGG + Intergenic
1177734931 21:25077111-25077133 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1177804617 21:25862239-25862261 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1177812230 21:25936664-25936686 ACCTGCTGGTACCTTGATCTTGG + Intronic
1178000252 21:28154071-28154093 ATTTGCCGGTACCTTGATCTTGG + Intergenic
1178165043 21:29964194-29964216 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1178176875 21:30112134-30112156 ACTTGCTGATACCTTGATCTTGG - Intergenic
1178237543 21:30859789-30859811 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1178252396 21:31016783-31016805 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1178374068 21:32051879-32051901 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1178519943 21:33281012-33281034 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1178846547 21:36178540-36178562 AACTGCTGGCACCTTGATTGCGG + Intronic
1179149829 21:38800268-38800290 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1179219580 21:39394582-39394604 ATCTGCCGGCACCTTGATTTTGG - Intronic
1179835207 21:44027140-44027162 ATTTGCTGATACTCTGATACAGG - Intronic
1180631522 22:17233421-17233443 ACTTGCTGGAACCTGGATCCAGG - Intergenic
1181341689 22:22185898-22185920 ATCTGCTTGTACTTTGATTTTGG + Intergenic
1181762136 22:25065999-25066021 ACCTGCTGGCACCTTGATCCTGG - Intronic
1181928956 22:26383903-26383925 ATTGGCTGGTACCCTGATCTTGG - Intergenic
1181936263 22:26441096-26441118 ATCTGCTGGCACCTTGATCTTGG - Intronic
1182246366 22:28961088-28961110 ATCTGCTGGCACCTTGATCTTGG - Intronic
1182807005 22:33081191-33081213 ATTAGCTGGCACCTTGATCTTGG + Intergenic
1182899673 22:33887377-33887399 ATCTGCTGGTATCTTGATCTTGG + Intronic
1183044275 22:35207351-35207373 ATATGCTGGTCCCTTGATCTTGG - Intergenic
1183614143 22:38932310-38932332 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1183897305 22:40979665-40979687 ATTTACTGGCACCTTGATCTTGG - Intergenic
1184509426 22:44924653-44924675 ATCTGCTGGCACCTTGATCTTGG + Intronic
1184622568 22:45693384-45693406 ATCTGCTGGTACCTTAATCTTGG - Intronic
1184966014 22:47972853-47972875 ATCTGCTGGCACCTTGATCCAGG - Intergenic
949303289 3:2609385-2609407 ATTTGCCGGCACCTTTATCCTGG + Intronic
949373024 3:3355423-3355445 ATCTGCTGGTACCTTGATCTTGG + Intergenic
949414777 3:3801692-3801714 GTTTGCTGACACCTTTATTCAGG + Intronic
949438249 3:4052109-4052131 ATTTTCTGGTGCCTTGATCTTGG - Intronic
949589866 3:5482909-5482931 ATTTGCTGTAACCTTAATCCTGG - Intergenic
949714712 3:6916532-6916554 ATCTGCTGGCACCTTGATTGTGG - Intronic
950220695 3:11193487-11193509 ATCTGCTGGTGCCTTGATCTTGG - Intronic
950626409 3:14250543-14250565 ATTGGCTGGCACCTTGATCATGG + Intergenic
950842420 3:15980184-15980206 ATCTGCTGGTGCCTTGATATTGG - Intergenic
950982730 3:17326286-17326308 ATTTGGTGGTACTTCCATTCTGG + Intronic
951681099 3:25295432-25295454 ATCTGCTGGTACCTTGATCTTGG + Intronic
952509832 3:34041906-34041928 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
952510400 3:34047822-34047844 ATGTGCTGGCACCTTGATTTTGG + Intergenic
952789153 3:37185327-37185349 ATCTGCTGGCACCTTGATCTTGG + Intergenic
952834762 3:37593466-37593488 CTATGCTGGCACCTTGATTGTGG - Intronic
952930532 3:38357086-38357108 ATTTGCTGGCACCTTAATTGTGG + Intronic
953206965 3:40839664-40839686 ATCTTCTGGCACCTTGATTGTGG - Intergenic
953747917 3:45589149-45589171 ATTTGCTGTTGCCTTGATCTTGG + Intronic
954898251 3:53995984-53996006 ATCTGCTGGTACCTTGATCTTGG + Intergenic
955152795 3:56385199-56385221 ATCTGCTGGCACCTTGATCTTGG - Intronic
955165117 3:56503406-56503428 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
955900507 3:63748658-63748680 ATCTGCTGGCACCTTGATCTTGG + Intergenic
956106973 3:65829527-65829549 ATCTGCTGGTGCCTTGATCTTGG + Intronic
956146137 3:66192442-66192464 ATCTGCTGGTGCATTGATTTTGG + Intronic
956714507 3:72066766-72066788 ATTTGCCGACACCTTGATTTTGG - Intergenic
956842156 3:73150834-73150856 ATTTGCTGGCACCTTGATCATGG - Intergenic
957185429 3:76935627-76935649 ATCTGCTGGCACCTTGATCTTGG - Intronic
957219265 3:77361546-77361568 ATCTGCTGGCACCTTGATCTTGG - Intronic
957428978 3:80076978-80077000 ATTTGCTGTTACCTTGATTTTGG + Intergenic
957463731 3:80558372-80558394 AGGTGCTGGTACCTTGATTTTGG - Intergenic
957590928 3:82196864-82196886 ATCTGCTGACACCTTGATTTTGG - Intergenic
959018071 3:101158484-101158506 ATCTGCTGGCACCTTGATATTGG + Intergenic
959019505 3:101173114-101173136 ATCTGCTGGCACCTTGATCTTGG - Intergenic
959444602 3:106423337-106423359 ATAAACTGGTACCTTGATTATGG + Intergenic
959892823 3:111575678-111575700 ACTTGCTGGCACCTTGATTTTGG - Intronic
959979844 3:112503691-112503713 ATCTGCTGGAACCTTGATCTTGG + Intergenic
960288544 3:115856743-115856765 ATTTGCTGGCACCCTGATCTTGG + Intronic
961101156 3:124200370-124200392 ATCTGCAGGCACCTTGATCCTGG - Intronic
961495302 3:127287302-127287324 GTTTGATGGTACCTTGATTTGGG + Intergenic
961702166 3:128753613-128753635 ATCTGCTGGAGCCTTGATTTTGG - Intronic
961945461 3:130682409-130682431 GTCTGCTGCTACCTTGATTTTGG + Intronic
962373724 3:134842233-134842255 ATCTGCTGGTGCCTTGATCTTGG + Intronic
962685461 3:137843288-137843310 ATCTGCTGGTACCTTGATCTTGG + Intergenic
962687402 3:137860748-137860770 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963062394 3:141235205-141235227 ATTTGCTGGGCCCATCATTCTGG + Intronic
963146839 3:142002890-142002912 ATTTGCTGGTGTCTTGATCCTGG - Intronic
963173731 3:142277458-142277480 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963291697 3:143496881-143496903 ATCAGCTGGCACCTTGATTTTGG - Intronic
963617732 3:147563784-147563806 ATTTGCTGGCACTTTGATCTTGG + Intergenic
963678533 3:148345497-148345519 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
963850906 3:150209484-150209506 ATCTGCTGGTACCTTGATCTTGG + Intergenic
963908342 3:150792853-150792875 ATCTGCTGGCACCTTGATCTTGG - Intergenic
964009881 3:151879553-151879575 ATCTGCTGATACCTTGATCTTGG + Intronic
964219621 3:154328386-154328408 ATTAGCTGGCACCTTGATCTTGG + Intergenic
964307755 3:155358990-155359012 ATTTGCTGGCACCTTGATCTTGG + Intergenic
964717833 3:159741534-159741556 ATTTGCTGTTTTCTTTATTCTGG - Intronic
964778535 3:160308985-160309007 ATCTGCTGGCACCTTGATCTTGG + Intronic
964938294 3:162122287-162122309 ATTTGCTGGCACATTGATCGTGG - Intergenic
965279639 3:166733494-166733516 ATCAGCTTGTACCTTGATTATGG - Intergenic
965523821 3:169696125-169696147 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
965759882 3:172064262-172064284 ATTTGTTGGTGCCTTGATTTTGG + Intronic
965768690 3:172158079-172158101 ATCTGCTGGTGCCTTGATCTTGG + Intronic
966124404 3:176558878-176558900 CCATGCTGGTACCTTGATTATGG - Intergenic
966170623 3:177076044-177076066 ATCTGCTGGCACCTTGATCTTGG - Intronic
966226711 3:177605582-177605604 ATCTGCTGGCACCTTGATCTTGG + Intergenic
966239716 3:177743041-177743063 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
966485511 3:180464977-180464999 ATATGATAGCACCTTGATTCTGG - Intergenic
966502787 3:180664191-180664213 ATTAGTTGGCACCTTGATCCTGG - Intronic
966571478 3:181449037-181449059 ATTTGCTGGTGCTTTGATTTTGG - Intergenic
966640844 3:182187897-182187919 ATCTGCTGATACCTTGATCTTGG - Intergenic
966752539 3:183336026-183336048 ACTTGGTGGCACCTTGATTGTGG + Intronic
966792815 3:183689442-183689464 ATCTGCTGGTGCCTTGATATTGG - Intergenic
967013934 3:185464800-185464822 ATCTGCTGGCACCTTGATTATGG - Intronic
967042399 3:185705685-185705707 ATCTGCTGGTGCCTTGATCTTGG - Intronic
967414466 3:189201096-189201118 ATGTGCTGGTGCCTTGATCTTGG + Intronic
969079337 4:4606425-4606447 CTCTGCTGACACCTTGATTCTGG - Intergenic
969085988 4:4656760-4656782 ACTTGCTAGTGCCTTGATTTTGG + Intergenic
969197211 4:5572568-5572590 ATCTGCAGGTACCTTGATTTCGG + Intronic
969256728 4:6007477-6007499 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
969283484 4:6187644-6187666 ATCTGCCGGTACCTTGATCTTGG + Intronic
969662030 4:8535981-8536003 AATTGCTGGGACCTTGGTTTTGG - Intergenic
969719254 4:8884127-8884149 ATTTGCTGGCACTTTGATCTTGG + Intergenic
969891654 4:10265311-10265333 ATTTGCTGGTACATTTTCTCAGG + Intergenic
969951952 4:10846169-10846191 ATCTGCTGGCACCTTGATCTTGG + Intergenic
969965246 4:10987249-10987271 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
970000063 4:11356051-11356073 ATTGGCTGGCACCTTGATTTTGG - Intergenic
970413737 4:15836206-15836228 ATCTGCTGGCACCTTAATCCTGG - Intronic
970599565 4:17630491-17630513 ATCTGCTGGTGCCTTGATCTTGG + Exonic
970651215 4:18180215-18180237 ATCTGCTGGTACTTTGATTTTGG - Intergenic
970694976 4:18666621-18666643 AACTGCTGGTACCTTGATGTTGG - Intergenic
970805254 4:20023572-20023594 ACCTGCTGGTGCCTTGATTTTGG - Intergenic
970813701 4:20127603-20127625 ATTTGTTGGCACCTTGATGGTGG + Intergenic
970968819 4:21957850-21957872 ATCTGCTGGCACCTTGATCTTGG + Intergenic
970970445 4:21977183-21977205 GTCTGCTGGTACCTTGATATTGG - Intergenic
971106710 4:23533784-23533806 ACTTGCTGGTACCTTGATTTTGG - Intergenic
971324629 4:25633912-25633934 ATGTGCTGGCACCTTGATCTTGG - Intergenic
971353900 4:25877123-25877145 ATTTACTGGCACCTTGATCTTGG + Intronic
971361949 4:25946329-25946351 ATCTGCTGGTGCTTTGATTTTGG - Intergenic
971431318 4:26570947-26570969 ATCTGCTGGCACCTTGATCTTGG - Intergenic
971739032 4:30497368-30497390 ATTTGCTGGCATTTTGATTTGGG - Intergenic
971938521 4:33185953-33185975 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
972165985 4:36284758-36284780 ATCTGCTAGCACCTTGATTTTGG - Intronic
972339960 4:38143581-38143603 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
972840152 4:42921259-42921281 ATCTGCTGGTACCTTGATCCTGG + Intronic
972973397 4:44604779-44604801 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
973199936 4:47488950-47488972 ATCTGCTGGCGCCTTGATTTTGG + Intronic
973228026 4:47808639-47808661 ATTGGCTGGTAGCTTAATCCAGG - Intronic
973604920 4:52577044-52577066 ATCTGCTGGCACCTTGATCTTGG + Intergenic
973627296 4:52785503-52785525 ATCTGCTGGCACCTTGATCTTGG + Intergenic
973836359 4:54813721-54813743 ATTTTCTGGCACCTTGATCTTGG - Intergenic
974129690 4:57738709-57738731 ATCTGCTGGCACCTTGATCTTGG - Intergenic
974216037 4:58848825-58848847 AGATTCTGGTACCTTGATACTGG + Intergenic
974331453 4:60484066-60484088 ATCTGCTTGTGCCTTGATTTTGG + Intergenic
974394728 4:61320141-61320163 ATTGGCTGGCACCTTGATCTTGG + Intronic
974623895 4:64397615-64397637 ATCTGCTGGTGCCTTAATTCTGG + Intronic
974837266 4:67266096-67266118 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
975182639 4:71364498-71364520 ATTTGCTGGTACCTAGATCTTGG - Intronic
975200548 4:71583112-71583134 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
975274949 4:72485959-72485981 AACTGCTGGTACCTTGATCTTGG + Intronic
975590478 4:75994814-75994836 ATCTGCTGGCACCTAGATTTTGG + Intergenic
975850136 4:78563602-78563624 ATCTGCTGGCACCTTGATCTTGG + Intronic
975931194 4:79525198-79525220 ATTTGCTGGTACCTTGATCTTGG - Intergenic
975974900 4:80083936-80083958 ATCTGTTGGTACCTTGATCTTGG - Intronic
976080934 4:81353996-81354018 ATATGCTGGTACCTTGATCTTGG - Intergenic
976376287 4:84349425-84349447 ATCTGCTGGTACCTTGATCTTGG - Intergenic
976517361 4:85984347-85984369 ATCTGCTGGTGCCTTGATCTTGG - Intronic
976543002 4:86299523-86299545 ATTTGCCTGTACCTTGATTTTGG + Intronic
976635270 4:87281096-87281118 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
976738903 4:88338855-88338877 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
976744999 4:88393766-88393788 ATCTGCTGGCACCTTGATTTTGG - Intronic
976839782 4:89418711-89418733 ATCTGCTGGCATCTTGATTTTGG - Intergenic
976854251 4:89583800-89583822 ATTTGCTGGCACCTTGATCATGG + Intergenic
976883350 4:89957585-89957607 ATCTGCTGGCACCTTGATCTTGG - Intergenic
976944075 4:90742579-90742601 ATCTGCTGACACCTTGATTTTGG + Intronic
977570027 4:98619784-98619806 ATCTGCTGGAGCCTTGATTTTGG - Intronic
977605661 4:98982856-98982878 ATCTGCGGGTGCCTTGATTTTGG - Intergenic
977682371 4:99810750-99810772 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
977976315 4:103270838-103270860 ATATGCTGGTGCCTTGATCTTGG - Intergenic
977983730 4:103357984-103358006 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
978331342 4:107615942-107615964 ATCTGCTGGCACCTTGATCTTGG + Intronic
978784364 4:112593050-112593072 ATTGGCTGGAACCTTGATCTTGG + Intronic
978875550 4:113636591-113636613 ATTTGCCTGTACCTTGATCTTGG - Intronic
978913874 4:114099649-114099671 ATTTGCAGGCATCTTGATTTTGG - Intergenic
978947225 4:114514819-114514841 ATCTGCTGGTACCATGATCTTGG + Intergenic
979045901 4:115863400-115863422 ATTTGCTGGCACTTTGATTTTGG - Intergenic
979069254 4:116180540-116180562 ATTTTCTGTTACCAGGATTCTGG + Intergenic
979134543 4:117093147-117093169 ATTTGCTGGCACCTTGACCTTGG + Intergenic
979348112 4:119612735-119612757 ATCTGCTGGTGCCTTGATCTTGG + Intronic
979349884 4:119631017-119631039 ATCTGCTGGCACTTTGATTTTGG + Intergenic
979400979 4:120249006-120249028 ATTGGCTGGTGCCTTGATCTGGG + Intergenic
979409746 4:120362150-120362172 ATCTGCTGGCACCTTGATCTTGG + Intergenic
979519733 4:121652620-121652642 GTTTGCTGGCACTTTGATTTTGG - Intergenic
979618152 4:122768099-122768121 ATCTGTTGGTACCTTGATCTTGG - Intergenic
979665766 4:123309291-123309313 ATCTGTTGGCACCTTGATCCTGG - Intronic
980101107 4:128542484-128542506 ATCTACTGGCACCTTGATGCAGG - Intergenic
980502691 4:133677066-133677088 ATTTGCTGATGCCTTGATCTTGG - Intergenic
981009597 4:139911811-139911833 ATGTGCTGGCACCTTGATCTTGG + Intronic
981038735 4:140199845-140199867 ATCTGCTGGCACCTTGATCTTGG - Intergenic
981260430 4:142712161-142712183 ATCTGCTGGTGCCTTGATCTTGG + Intronic
981314675 4:143330529-143330551 ATCTGCTGGTACCTTGATGGAGG + Intergenic
981549773 4:145932129-145932151 ATCTGCTGGCACCTTGATCTTGG + Intronic
981651038 4:147059366-147059388 ACTTGCTGGCACCTTGATCTTGG + Intergenic
981661488 4:147172377-147172399 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
981869233 4:149466817-149466839 ATCTGCTGGAACCTTGATCTTGG - Intergenic
982099620 4:151955167-151955189 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
982268664 4:153564406-153564428 ATCTCTTGGTACCTTGATCCTGG + Intronic
982403365 4:154993455-154993477 CTGTGCTGGTACCTTGATCTTGG - Intergenic
982491095 4:156030721-156030743 ATTTGCTAGAGCCTTGATCCTGG + Intergenic
982554612 4:156843286-156843308 ATCTGCTGGTGCCTTGATCTTGG + Intronic
982680480 4:158422327-158422349 ATCTGCTGGCACCTTGATCCTGG + Intronic
982699177 4:158639979-158640001 ATCTGCTGGCACCTTGATCTTGG + Intronic
983672339 4:170252596-170252618 ATCTGCTGGCACCTTAATTTTGG + Intergenic
983746458 4:171206019-171206041 ATCTGCTGGCACCTTGATCCTGG + Intergenic
984053851 4:174901298-174901320 ATTTGATGTTACCTTCTTTCTGG + Intronic
984399507 4:179243832-179243854 ATCTGCTGATGCCTTGATTTTGG - Intergenic
984432015 4:179661901-179661923 ACCTGCTGGTACCTTGATCTTGG + Intergenic
984633215 4:182082170-182082192 ATCTGCTGGCACCTTGATCTTGG - Intergenic
985247012 4:187989203-187989225 ATCTGCTGGCACCTTGATCTTGG - Intergenic
985519011 5:362261-362283 ATTTGGTGGCACCTTGATCATGG + Intronic
986143903 5:5058496-5058518 ATCTGCTGGTACCTTGGTCCTGG + Intergenic
986341852 5:6795749-6795771 ATCTGCTGGCACCTTGATCTTGG + Intergenic
986674540 5:10171469-10171491 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
986865377 5:11980647-11980669 ATTTGCTGGCACCTTGATCTTGG + Intergenic
986988658 5:13526813-13526835 ATCTGCTGGCACCTTGATCTTGG - Intergenic
987690464 5:21259883-21259905 ATCTGCTGGTGCCTTGATATTGG - Intergenic
988054538 5:26076650-26076672 CTTTGCTGCTACTTTCATTCTGG + Intergenic
988090739 5:26537752-26537774 CTTTGCTGGTACCTCGATCTTGG - Intergenic
988112783 5:26845015-26845037 ATCTGCTGGTACCCTGATCTTGG - Intergenic
988163697 5:27554421-27554443 ATCTGCTGGCACCTTGATCTTGG - Intergenic
988172413 5:27675884-27675906 ATTTGCTGGCACCTTGATCTGGG + Intergenic
988206814 5:28147835-28147857 ATCTGCCGGCACCTTGATTTTGG - Intergenic
988224369 5:28392908-28392930 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
988289356 5:29265791-29265813 ATTTGCTGGTGCCTCGATGTTGG - Intergenic
988393498 5:30666480-30666502 ATCTGCTGTTACCTTGATATTGG - Intergenic
988442963 5:31253058-31253080 ATTTGCTGGTGCCTTGATCTTGG - Intronic
988451720 5:31350648-31350670 ATTTACGGGTATCTTGATTATGG + Intergenic
988832616 5:35002671-35002693 ACTTGCTGGCACCTTGATCTTGG + Intronic
989164231 5:38419003-38419025 ATTGGCTGGCACCTTGATCTGGG - Intronic
989311133 5:40019439-40019461 ATCTACTGGTACCTTGATCTGGG - Intergenic
989476071 5:41874467-41874489 ATATGCTGGTGCCTTGATCTTGG - Intergenic
989513414 5:42314842-42314864 ATTGGCTGGCACCTTGATCTGGG + Intergenic
989744938 5:44817786-44817808 ATCTGCTGGTGCCTTGATCTTGG + Intronic
989753609 5:44924106-44924128 ATTTGCTGGCATCTTGATCTTGG + Intergenic
989753791 5:44926294-44926316 ATTTGCTGGTGCCTTGAGCTTGG + Intergenic
990058124 5:51611334-51611356 ATCTGCTGGCACCTTGATCTTGG + Intergenic
990145192 5:52751781-52751803 ATTTGCTGGGGCCTTGATCTTGG - Intergenic
990210162 5:53474594-53474616 ATCTGCTGGCACCTTGATCTTGG - Intergenic
990465463 5:56067301-56067323 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
990509668 5:56479244-56479266 ATCTGCTGGCACCTTGCTCCTGG - Intronic
990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG + Intergenic
990657722 5:57975909-57975931 ATCTGCTGGCACCTTGATCCTGG + Intergenic
991197507 5:63953569-63953591 ATTTTCTTATACCTTGAATCTGG - Intergenic
991197610 5:63954731-63954753 ACCTGCTAGTACCTTGATTTTGG + Intergenic
991572127 5:68065962-68065984 ATCTTCTGGTCCCTTGATTTTGG + Intergenic
991929032 5:71733526-71733548 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
992181870 5:74205377-74205399 ATCTGCTGGCACCTTGATTGTGG + Intergenic
992598036 5:78366025-78366047 ATCTGCTGGGACCTTGATCTTGG - Intronic
992810424 5:80382313-80382335 ACATGCTGGTACCTTGATCTCGG - Intergenic
992845121 5:80738980-80739002 ATCTGCTGGCACCTTGATTTTGG + Intronic
992849784 5:80795397-80795419 ATCTGCTGGTACCTTGATCTTGG - Intronic
992919162 5:81494621-81494643 ATTGGCTGGCACCTTGATCTTGG + Intronic
993049275 5:82907966-82907988 ATCTGCTGGTATCTTGATCTTGG - Intergenic
993107259 5:83613269-83613291 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
993322920 5:86496376-86496398 ATCTGCTGGTGCCTTAATTGTGG + Intergenic
993334058 5:86634956-86634978 ATCTTCTGGTACCTTGATCCTGG - Intergenic
993488469 5:88516020-88516042 ATCTGCTGGTACCCTGATCTCGG - Intergenic
993699081 5:91097157-91097179 ATCTGCTGGCACCTTGATCTTGG - Intronic
993921745 5:93813700-93813722 ATCTGCTGGTACTTTTATTTTGG + Intronic
994327347 5:98463740-98463762 ATCTGCTGGTATCTTGATCTTGG + Intergenic
994416920 5:99483988-99484010 ATCTGCTGGCACCTTGATTTTGG - Intergenic
994463054 5:100091186-100091208 ATCTGCTGGCACCTTGATTTTGG + Intergenic
994516313 5:100776736-100776758 ATTTGCTAGCACCTTGATCTTGG + Intergenic
994649816 5:102512411-102512433 ATTTGCAATTACATTGATTCAGG - Intergenic
995512021 5:112919726-112919748 ATCTGCTGGTGCCTTGGTCCTGG + Intronic
995999416 5:118340949-118340971 GTCTGCTGGTACCTTGATCTTGG + Intergenic
996049028 5:118910805-118910827 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996251345 5:121337144-121337166 ATTTGCTGATACATTGATGGTGG + Intergenic
996315589 5:122157374-122157396 TCCTGCTGGTACCTTGATTTCGG - Intronic
996331261 5:122331608-122331630 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996678938 5:126208992-126209014 ATTTGCCGCTACCTTGATCTTGG - Intergenic
996929509 5:128869265-128869287 ACTTGCTGGTAGATTGCTTCTGG - Intronic
997087254 5:130816323-130816345 ACCTGCTGGTACCTTGATTTTGG - Intergenic
997877279 5:137560618-137560640 ATCTGCTGGCACCTTGATCTTGG - Intronic
998537071 5:142943373-142943395 ATTTGATGGTGCCTTGATCTTGG - Intronic
998671450 5:144358706-144358728 ATCTGCTGGCACCTTGATCTTGG - Intronic
998784862 5:145698521-145698543 ATTGGCTGGCACCTTGATCTTGG - Intronic
998980974 5:147701800-147701822 ATGTGCTGGTGCCTTGATCCTGG + Intronic
999469505 5:151839830-151839852 ATTAGCTGCCACCTTGATTTTGG + Intronic
999490209 5:152042814-152042836 ATCTGCTGATGCCTTGATTTTGG - Intergenic
999578317 5:153005777-153005799 AGATGCTGGTACCTTGATCTTGG + Intergenic
999801291 5:155040052-155040074 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1000308365 5:160017313-160017335 AATTGCTGGCACCTTGATCTTGG - Intronic
1000308474 5:160018228-160018250 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1000862877 5:166477215-166477237 ACCTGCTGGCACCTTGATTTTGG + Intergenic
1001021754 5:168188994-168189016 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1001446862 5:171792072-171792094 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1001730261 5:173948724-173948746 ATTTGCTGGCACCTTGATCTTGG - Intronic
1001871194 5:175157376-175157398 ATTTGCTGGTGTCTTGATCTTGG + Intergenic
1002601954 5:180358859-180358881 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1002610013 5:180411197-180411219 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1002883988 6:1277568-1277590 ATCTGCTGGTGCCTGGATCCTGG + Intergenic
1003050271 6:2774359-2774381 CCTTGTTGATACCTTGATTCTGG - Intronic
1003118599 6:3300547-3300569 ATCTGCTGGTGCCTTAATCCTGG + Intronic
1003193677 6:3896018-3896040 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1003256246 6:4477472-4477494 ATTGGCTGGCACCTTGATTTTGG - Intergenic
1003622129 6:7709743-7709765 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1003720486 6:8696536-8696558 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1004289281 6:14351666-14351688 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1004371803 6:15059270-15059292 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1004604289 6:17179311-17179333 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1004756998 6:18621092-18621114 ATCTGTTGGCACCTTGATTTTGG + Intergenic
1005070901 6:21861430-21861452 ATTTGCTGATGCCTTGATCTTGG - Intergenic
1005518264 6:26575007-26575029 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1005603440 6:27450527-27450549 ATCTGCTAGTACCTTGATCTTGG + Intergenic
1005610674 6:27521332-27521354 ATCAGCTGGAACCTTGATTTTGG - Intergenic
1005980906 6:30835768-30835790 ATCTGCTGGTACCTGGATCTTGG + Intergenic
1006810217 6:36815543-36815565 ATTTGCTGGTGCCTTGATATTGG + Intronic
1007036068 6:38674894-38674916 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1007076114 6:39067381-39067403 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1008397138 6:51022180-51022202 ATCTGCTGGTATCTTGATCTTGG - Intergenic
1008488434 6:52060083-52060105 ATTTGTTGGTTCAGTGATTCAGG - Intronic
1008625772 6:53315123-53315145 ATTTGCTGGCACCTTGATCATGG - Intronic
1008746372 6:54674414-54674436 AGATGCTGATGCCTTGATTCTGG + Intergenic
1009304809 6:62075349-62075371 ATTTGCTGGTGCTTTGATTATGG + Intronic
1009336916 6:62502404-62502426 ATCTGCTGGAGCCTTGATTTTGG + Intergenic
1009465246 6:63961135-63961157 ATCTGCTGGCACCTTGATCTTGG - Intronic
1009623136 6:66101264-66101286 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1009867887 6:69419688-69419710 ATCTGCTGGCACCATGATCCTGG - Intergenic
1009868136 6:69423521-69423543 ATCTGCTGGTATCTTGATCTTGG - Intergenic
1010104991 6:72156675-72156697 ATATGTTGATACCTTGATTGTGG + Intronic
1010225415 6:73484340-73484362 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1010470169 6:76217800-76217822 ATCTGCTGGTACCTTGATCCTGG - Intergenic
1010581345 6:77600587-77600609 ATCTGCTAGTACCTTGATCTTGG + Intergenic
1010726316 6:79337710-79337732 ATTTGCTGATAACTTGATCTTGG + Intergenic
1010831360 6:80534394-80534416 ATTTGCTGGTGGCTTGATCTTGG + Intergenic
1010950402 6:82030403-82030425 CATTGCTAGTACCTTGATTTTGG - Intergenic
1011198207 6:84804552-84804574 CCTTGCTGATACCTTGATTTTGG - Intergenic
1011289926 6:85766309-85766331 ATCTGCTGGCACCTTGATGTTGG - Intergenic
1011354250 6:86457814-86457836 ATCTGCTGGCCCCTTGATTTTGG - Intergenic
1011462614 6:87620585-87620607 ATTTTCAGGTACCCTGATACTGG - Intronic
1011909134 6:92412894-92412916 ATTTGCTGATAACCTGATTCAGG - Intergenic
1012198340 6:96373674-96373696 ATTTGCTGGCACCTTGACCTTGG - Intergenic
1012282515 6:97345531-97345553 ATCTGCTGGTGCCTTGACTTTGG - Intergenic
1012560341 6:100572337-100572359 ATCTGCTGATTCCTTGATTTGGG + Intronic
1013241994 6:108254749-108254771 TTTTGCTGATCCCTTGACTCTGG - Intronic
1013374976 6:109505898-109505920 ATTTGCTGGTACCTTGATTCTGG - Intronic
1013446853 6:110237948-110237970 ATCTGCTGGCACCTTGATCTTGG - Intronic
1013805227 6:113989343-113989365 ATCTGCTGGTGCCTTCATTTTGG - Intronic
1014242303 6:119031470-119031492 ATTGGCTGCTACCTTGATCTTGG + Intronic
1014577411 6:123090696-123090718 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1014627938 6:123752247-123752269 ATGTGCTGGCACCTTGATCTTGG + Intergenic
1014666973 6:124250197-124250219 ATCTGCTGGTGCCTTGATCAGGG + Intronic
1015091849 6:129367974-129367996 CATTGCTGGTACCTTGATCTTGG - Intronic
1015234392 6:130953878-130953900 ATTTTCTGGTGCCTTGATCTGGG + Intronic
1015358094 6:132304293-132304315 AACTGCTGGTGCCTTGATTTTGG + Intronic
1015758010 6:136627721-136627743 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1015807422 6:137125167-137125189 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1015869179 6:137759031-137759053 ATCTGCTGGCACCTCGATTGTGG - Intergenic
1016019440 6:139220226-139220248 ATCTGCTGGTACCTTGATACTGG + Intergenic
1016167708 6:140967827-140967849 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1016265389 6:142227321-142227343 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016382018 6:143494005-143494027 ATCTGCTGATACCTTGATCTTGG - Intergenic
1016536348 6:145111006-145111028 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016536604 6:145113430-145113452 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1016553084 6:145304385-145304407 ATATGCTAGTGCCTTGATCCTGG - Intergenic
1016562168 6:145408779-145408801 ATATGCTGGTGCCTTGATCTTGG - Intergenic
1017192362 6:151668146-151668168 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1017282719 6:152640810-152640832 ATTTGAAGGTGCCTTGATCCTGG + Intergenic
1017606738 6:156142737-156142759 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1017792892 6:157817093-157817115 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1017807653 6:157960006-157960028 ATCTGCTGCTACCTTGATCTTGG + Intergenic
1018006029 6:159622837-159622859 AGATGCTGGTACCTTGATATTGG - Intergenic
1018072666 6:160179291-160179313 ATCTGCTGGCACCTTGATCTTGG - Intronic
1018484083 6:164222616-164222638 ATCTGTTGGTGCCTTGATTTTGG + Intergenic
1018491004 6:164293378-164293400 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1018504102 6:164444837-164444859 ATCTGCTGGCAGCTTGATTTTGG + Intergenic
1018537366 6:164835785-164835807 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
1018916469 6:168135435-168135457 ACCTGCTGGCACCTTGATCCCGG - Intergenic
1019085493 6:169471838-169471860 ATCTGCTGGTACCATGATCTTGG - Intronic
1019945959 7:4329472-4329494 ATCTGCTGGCACCTTGATTATGG + Intergenic
1020356539 7:7281999-7282021 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1020412727 7:7911287-7911309 ATCTGCTGGTGCCTTGATGTTGG - Intronic
1020814762 7:12891681-12891703 ATTTCCTGACACCTTGATTGTGG + Intergenic
1020896265 7:13944306-13944328 ATCTGCTGGTGACTTGATGCTGG - Intronic
1021160294 7:17264292-17264314 ATCTGCTGGCACCTTAATTTAGG + Intergenic
1021289021 7:18821002-18821024 ATCTGCTGGCACCTTGATCTTGG - Intronic
1021345624 7:19524790-19524812 ATTGGCTGGCACCTTGATCATGG - Intergenic
1021673220 7:23053651-23053673 ATCTGCTGGGACCTTGATCTTGG + Intergenic
1021694956 7:23267546-23267568 ATGTGCTGGTACCTTGAACTTGG - Intronic
1021866280 7:24961630-24961652 ATCTGCTGGTGCCTTGATATTGG + Intronic
1022748028 7:33192735-33192757 ACCTGCTGGCACCTTGATTTTGG - Intronic
1022809595 7:33855866-33855888 ATCAGCTGGCACCTTGATCCTGG + Intergenic
1022934999 7:35165784-35165806 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1022952612 7:35352842-35352864 ATTTGCTTGTACATAGACTCTGG + Intergenic
1023062477 7:36341839-36341861 ATTTGATGGTGCCTTGATTTTGG + Intronic
1023122212 7:36921123-36921145 ATTTGCTGGTGCCTTGATTTTGG + Intronic
1023368847 7:39491789-39491811 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1023385013 7:39647805-39647827 ATGTGCTGGCACCTTGATCTTGG + Intronic
1023532020 7:41167679-41167701 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1023589355 7:41764772-41764794 ATCTGCTGGCACCTTGATCTGGG + Intergenic
1023679928 7:42675065-42675087 ATCTGCTAGCACCTTGATTATGG - Intergenic
1023770403 7:43551818-43551840 ATCTGCTAGTACCTTGATCTTGG - Intronic
1024267790 7:47619950-47619972 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1024364963 7:48509954-48509976 ATCTGCCAGCACCTTGATTCTGG + Intronic
1024930932 7:54665850-54665872 ATATGCTGGCACCTTGATCTTGG + Intergenic
1024939963 7:54751997-54752019 ACCTGCTGGTACCTTGATCTTGG + Intergenic
1026098830 7:67368266-67368288 ATTTGCTGGCACTTTGATCTTGG + Intergenic
1027367019 7:77469037-77469059 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027457928 7:78416887-78416909 ATCTGCTGGCACCTTGATCTTGG + Intronic
1027602311 7:80254348-80254370 ATTTGCTGGCACCTGGATCTTGG + Intergenic
1027673740 7:81133696-81133718 ATTTGCTGGCACCTTGATCTTGG - Intergenic
1027834824 7:83227480-83227502 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027844927 7:83360916-83360938 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1027963009 7:84970577-84970599 ATCTGCTGGCACCTTGATTTTGG + Intergenic
1028210587 7:88069313-88069335 AGTTGCTGGCACCTTGATATTGG + Intronic
1028629077 7:92913917-92913939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1028761950 7:94507127-94507149 ACTTGCTGTTACCTTGGTTAAGG - Intergenic
1028777064 7:94689265-94689287 ATCTGCTGGTACCTGGATCTTGG - Intergenic
1028787667 7:94814232-94814254 ATCTGCTGGAACCTTGATCATGG + Intergenic
1029181802 7:98707478-98707500 ACTTGCTGGCACCTTGATCTTGG - Intergenic
1029601562 7:101566554-101566576 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1029963413 7:104712302-104712324 AGCTGCTGGTACCTTGATCTTGG - Intronic
1030206312 7:106955448-106955470 ATCTGCTGGCACCTTGATTTTGG + Intergenic
1030353189 7:108513050-108513072 AATTGTTGGTGCCTTGATTTTGG + Intronic
1030602148 7:111604754-111604776 ATATGCTGGCACCTTGATCTTGG - Intergenic
1030662358 7:112234341-112234363 ATTTGTTGATACCTTGATCTTGG - Intronic
1030866192 7:114704330-114704352 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1030874794 7:114800471-114800493 ATCTGCTGGTACATTGATCTTGG - Intergenic
1030914583 7:115296594-115296616 ATGTGATGGCACCTTGATTTTGG + Intergenic
1030961371 7:115927591-115927613 ATTTTCTGGCACCTTGATCTTGG + Intergenic
1031016158 7:116578864-116578886 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1031106746 7:117553111-117553133 ATCTGCTGGCACCTTGATCTTGG + Intronic
1031637850 7:124123039-124123061 ATTAGCTGGCATCTTGATGCTGG - Intergenic
1031642174 7:124178683-124178705 ATCTGCTGGTACCTTGACCTTGG + Intergenic
1031800284 7:126234497-126234519 ATTTTCTGACCCCTTGATTCTGG - Intergenic
1031882412 7:127211782-127211804 ATCTGTTGGCACCTTGATCCTGG + Intronic
1031914442 7:127549752-127549774 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1032696173 7:134338478-134338500 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1032762350 7:134955509-134955531 ATCTGCTTGCACCTTGATTTTGG - Intronic
1032881301 7:136093352-136093374 ATATGCTGGTACTTTGATCTTGG - Intergenic
1032896829 7:136260857-136260879 ACTTGCTGGCTCCTTGCTTCTGG - Intergenic
1032993306 7:137417892-137417914 ATTTGCTAGCACCTTGATCTTGG + Intronic
1033018657 7:137699070-137699092 ATCTGCTGGCACCTTGATCTTGG - Intronic
1033057462 7:138071775-138071797 ATTGGCTGGCACCTTGATCTTGG + Intronic
1033183622 7:139204727-139204749 AGATGCTGGTGCCTTGATTTTGG + Intergenic
1033567401 7:142592736-142592758 ATTTGCTGCTTCCTTGAGACAGG - Intergenic
1033896119 7:146073044-146073066 ATTGGCTGGCACCTTGATGGGGG - Intergenic
1034032401 7:147782465-147782487 ATCTGCTGGCACCTTGCTTTTGG - Intronic
1034156855 7:148962879-148962901 ATCTGCTGCTGCCTTGATTCAGG + Intergenic
1034319810 7:150169511-150169533 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1034772940 7:153797715-153797737 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1034922220 7:155092836-155092858 ATTTGCTAGCACCTTGATCTCGG + Intergenic
1035003693 7:155638866-155638888 ATCTGCTGGCACCTTGATCTTGG - Intronic
1035082531 7:156229132-156229154 ATCTTCTGGCACCTTGATTTTGG - Intergenic
1035899359 8:3441218-3441240 CTTTGCTGACACCTTGATTTTGG + Intronic
1035937903 8:3862978-3863000 ATCTGTTGGTACCTTGATATTGG - Intronic
1036098555 8:5751992-5752014 ATCTGCTGGCACCTTGATTTTGG - Intergenic
1036145463 8:6250851-6250873 ATCTGCTGGCACCTTGATATTGG + Intergenic
1036443536 8:8802530-8802552 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1036591241 8:10170441-10170463 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1036622873 8:10437530-10437552 ATCTGCTGCCACCTTGATCCTGG + Intergenic
1036917628 8:12820106-12820128 ATCTACTGGCACCTTGATTTTGG - Intergenic
1037002043 8:13731817-13731839 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1037586927 8:20283417-20283439 ATCTGCTGGCACCTTGATCTTGG + Intronic
1037613606 8:20496909-20496931 ACTTGCTGGCACCTTGATCCTGG + Intergenic
1038282905 8:26181917-26181939 ATATGATGGCACCTTGATTTTGG + Intergenic
1038286852 8:26212882-26212904 ATCTGCTGGAGCCTTGATTTGGG + Intergenic
1038394315 8:27235851-27235873 ATCTGCTGGCACCTTGATATTGG + Exonic
1038854573 8:31317357-31317379 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1038888126 8:31688408-31688430 ATCTGCTGGTACCTTGATCTTGG + Intronic
1039035894 8:33358952-33358974 ATCAGCTGGCACCTTGATTTTGG + Intergenic
1039155482 8:34552066-34552088 TTTTGCTGGTTTCTTTATTCAGG + Intergenic
1039211553 8:35220780-35220802 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1039354753 8:36802652-36802674 ATTTGCGGTTCCCTTGATTTCGG - Intronic
1039385006 8:37127865-37127887 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1040100724 8:43500791-43500813 ATTGGCTGGAACCTTGGTTTGGG + Intergenic
1040406087 8:47104326-47104348 ATTTTCTGGCACCTTGATCTTGG + Intergenic
1041735590 8:61107384-61107406 ATTTGCTGATACCTTGATCTTGG - Intronic
1041740512 8:61152164-61152186 ATCTGCTGGCACCTTGATCTTGG - Intronic
1042103495 8:65298651-65298673 ATCTGTTGGTGCCTTGATCCTGG + Intergenic
1042166908 8:65954654-65954676 ATCTGCTGGCACCTTGATTGTGG + Intergenic
1042168716 8:65972040-65972062 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1042210162 8:66372109-66372131 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1042225306 8:66510659-66510681 ATCTGCTGGCACCTTGATCTTGG - Intronic
1042350195 8:67769215-67769237 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1042351392 8:67781057-67781079 ATGTGGTGGTACTTTGATTTTGG + Intergenic
1042357208 8:67841345-67841367 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1042454302 8:68982671-68982693 ATCTGCTGATACCTTGATCTTGG + Intergenic
1042482258 8:69317535-69317557 ATTTCCTGGAACCTTGATGTTGG + Intergenic
1042596164 8:70450435-70450457 ATTTGCCGGTAACTTGATCTTGG + Intergenic
1042659662 8:71140776-71140798 CTTTGCTGGTGCCTTGATCTTGG - Intergenic
1042699462 8:71596156-71596178 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1042807559 8:72788279-72788301 TCCTGCTGGTACCTTGATTTTGG - Intronic
1042935234 8:74051783-74051805 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1043056237 8:75443192-75443214 ATCTGCTGGTACTTTGATCTTGG + Intronic
1043158368 8:76815377-76815399 ATTGGCTGGCACCTTGATCTTGG - Intronic
1043322423 8:79006052-79006074 ATCTGCTGGCACCTTGATTTTGG - Intergenic
1043380973 8:79701857-79701879 AGATGCTGGCACCTTGATTTTGG - Intergenic
1043411098 8:79996472-79996494 ATATGCTTGTGCCTTGATCCTGG - Intronic
1043867844 8:85395900-85395922 ATCTGCTGGTACCTTGATCTTGG - Intronic
1044290062 8:90457820-90457842 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1044385835 8:91587375-91587397 ATGTACTGGTACCTTGATCTTGG + Intergenic
1044443759 8:92249898-92249920 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1044473596 8:92600704-92600726 AACTGTTGGTACCTTGATTTTGG + Intergenic
1044542717 8:93425772-93425794 ATCTCCTGGTACCTTGATCTTGG - Intergenic
1044926266 8:97211366-97211388 ATCTGCCAGTACCTTGATTTTGG - Intergenic
1045035242 8:98171638-98171660 ATTTACTGGCACCTTGATCTTGG - Intergenic
1045356965 8:101397768-101397790 ATCTGGTGGTCCCTTGATGCTGG + Intergenic
1045411331 8:101923190-101923212 ATTTGCTGGCATCTTGATCTTGG + Intronic
1045830714 8:106457347-106457369 AGTTGCTGGCACCTTGATATTGG + Intronic
1046225481 8:111273344-111273366 GTTTGCTGGTTCTTTGATTATGG + Intergenic
1046382277 8:113466992-113467014 ATCTGCTGGTGCCCTGATTGTGG + Intergenic
1046678503 8:117139450-117139472 ATTTGCTAGCAGCTTGATTATGG + Intronic
1046738562 8:117804337-117804359 ATCTGCTGGTGCCTTGATCTGGG + Intronic
1046831657 8:118752756-118752778 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1046944740 8:119963943-119963965 ATCTGCTGGCACCTTGATCTTGG - Intronic
1047000291 8:120566467-120566489 ATCTGCTGGCACCTTGATCTTGG + Intronic
1047051641 8:121119095-121119117 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1047606471 8:126479762-126479784 ATTTGCTAGTACCTTGATCTTGG - Intergenic
1047664256 8:127073194-127073216 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1047824845 8:128562139-128562161 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1047862844 8:128987826-128987848 ATTTGCTGGCACCTTGATCTTGG + Intergenic
1047879977 8:129182396-129182418 ATCTCCTGGTGCCTTGATTTTGG - Intergenic
1048382641 8:133880929-133880951 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1048492463 8:134906716-134906738 ATTTGCTGGTGCCTTAATCTTGG - Intergenic
1048602758 8:135935698-135935720 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1049111111 8:140644062-140644084 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1049390890 8:142370151-142370173 ATCTGCTGGCACCTTGATCCTGG + Intronic
1049902767 9:185903-185925 ACTTCCTGGCACCTTGATTTTGG - Intergenic
1050067261 9:1773015-1773037 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1050103928 9:2146116-2146138 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1050149496 9:2605185-2605207 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1050158256 9:2690769-2690791 CTCTGCTGATACCTTGATTCTGG - Intergenic
1050206120 9:3198221-3198243 ATTTGCTGGTAGCTAAATTATGG + Intergenic
1051138298 9:13949620-13949642 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1051446622 9:17146619-17146641 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1052074421 9:24122754-24122776 ATCTGCGGGTGCCTTGATCCTGG + Intergenic
1052193588 9:25685190-25685212 ATTAGCCAGTACCTTGATCCTGG + Intergenic
1052378742 9:27746198-27746220 ATCTGCTGGTACCTAGATCTTGG + Intergenic
1052620979 9:30910157-30910179 ATCTGCTGGCATCTTGATTTCGG - Intergenic
1052806350 9:33017371-33017393 TTCAGCTGGTACCTTGATCCTGG - Intronic
1053027081 9:34739034-34739056 ATTTTCATGTACCATGATTCTGG + Intergenic
1053422819 9:37990733-37990755 AGTTTCTGGTCCCTTCATTCTGG - Intronic
1053571026 9:39307330-39307352 ATTTGCTGGAATTTTGATTGGGG - Intergenic
1053745791 9:41196187-41196209 ACTTCCTGGCACCTTGATTTTGG - Intronic
1053836911 9:42147938-42147960 ATTTGCTGGAATTTTGATTGGGG - Intergenic
1054092586 9:60866032-60866054 ATTTGCTGGAATTTTGATTGGGG - Intergenic
1054114064 9:61141937-61141959 ATTTGCTGGAATTTTGATTGGGG - Intergenic
1054126119 9:61311682-61311704 ATTTGCTGGAATTTTGATTGGGG + Intergenic
1054593695 9:67040566-67040588 ATTTGCTGGAATTTTGATTGGGG + Intergenic
1054710894 9:68509776-68509798 ATTTGCTGGTACCTAGCCTTGGG + Intronic
1054916796 9:70501797-70501819 ATCTGCTGGTAACTTGATCTCGG + Intergenic
1055015710 9:71615784-71615806 ATTGGCTGGCACCTTCATTTTGG - Intergenic
1055505260 9:76941774-76941796 CTTTGCTAGTACTTTAATTCTGG + Intergenic
1055578246 9:77681207-77681229 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1055874708 9:80928043-80928065 ACTTGCAGGTGCCTTGATTTTGG + Intergenic
1056255769 9:84798094-84798116 ATCTGCTGGTGCCTTGATATCGG - Intronic
1056693366 9:88826553-88826575 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1057137776 9:92705982-92706004 GTCTGCTGGCACCTTGATTTTGG - Intergenic
1057930927 9:99192201-99192223 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1057974400 9:99588941-99588963 ATCTGCTGACACCTTGATTTTGG + Intergenic
1058032224 9:100212966-100212988 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1058138228 9:101330875-101330897 ACCTGCTGGCACCTTGATTTTGG - Intergenic
1058404860 9:104661366-104661388 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1058478741 9:105369294-105369316 ATTTGCTGGTGCCTTGTTCTTGG - Intronic
1058724822 9:107792399-107792421 ATTGGCTGGCACCTTGATCTTGG + Intergenic
1058748410 9:108015157-108015179 ATTTGCTGATAGCTTGAATGGGG - Intergenic
1058783423 9:108362397-108362419 ATCTGCTGGCACCTTGATCATGG + Intergenic
1058849968 9:109002173-109002195 ATCTGTTGGTGCCTTGATCCTGG - Intronic
1058892325 9:109371544-109371566 ATTTGCTGGCATCTTGACTTTGG + Intergenic
1059038139 9:110781679-110781701 ATCTGCTGGCACCTTGATCTTGG - Intronic
1059507705 9:114814689-114814711 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG + Intergenic
1059853304 9:118367510-118367532 ATCTGCTGGCACCTGGATCCTGG - Intergenic
1059894897 9:118852072-118852094 CCCTGCTGGTACCTTGATTTCGG - Intergenic
1060087905 9:120717993-120718015 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1060316739 9:122518378-122518400 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1060607758 9:124932755-124932777 ATCTGCTGGCACCTTAATTTTGG - Intronic
1060768124 9:126310078-126310100 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1060898344 9:127234724-127234746 ATCTGCTGGTACCTGGATCTTGG - Intronic
1061277067 9:129575192-129575214 ATCTGCTGGCACCTTGATCTCGG + Intergenic
1186096839 X:6111398-6111420 ATCTGCTAGCACCTTGATCCTGG + Intronic
1186115497 X:6301271-6301293 ATTTGCTGGTGCCTTGACCTTGG - Intergenic
1186170536 X:6871936-6871958 ATCTGCTGGTGCCTTAATTTTGG - Intergenic
1186201226 X:7157200-7157222 AGATGCTTGTTCCTTGATTCAGG + Intergenic
1186528199 X:10268858-10268880 ACCTGCTGGCACCTTGATTTTGG + Intergenic
1186562026 X:10622655-10622677 ATCTGCTGGCACCTTGATCTTGG + Intronic
1186581461 X:10824334-10824356 CTTTGCTGGGACCTTCACTCTGG + Intronic
1186683708 X:11902323-11902345 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1186736295 X:12468448-12468470 ATTTGATGTTACCATGATTATGG + Intronic
1186987064 X:15028557-15028579 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1187365410 X:18662131-18662153 ATCTGCTGGCACCTTGATCGTGG + Intronic
1187618956 X:21029486-21029508 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1187795065 X:22994667-22994689 GTCTGCTGGTAACTTGATTTTGG - Intergenic
1187851639 X:23596934-23596956 ATTTACTGGTACCAGGACTCTGG + Intergenic
1188134079 X:26472494-26472516 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1188363163 X:29281897-29281919 ATTGGCTGGTACCTTGATCTTGG - Intronic
1188384963 X:29545067-29545089 ACTTGCTGGCACCTTGATATTGG + Intronic
1188467096 X:30494036-30494058 ATCTGCTAGTACCTTGATCTTGG - Intergenic
1188473796 X:30568828-30568850 GTTTGCTGGTATCTTAATTCTGG + Intronic
1188760755 X:34026806-34026828 GTTTGCTGGCACCTTGATCATGG - Intergenic
1188919270 X:35951695-35951717 ATTTGCTATTTCCTAGATTCTGG + Intronic
1189106121 X:38237398-38237420 ATCTGCTGGTGCCTTGATCCTGG + Intronic
1189178476 X:38981295-38981317 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1189255156 X:39632310-39632332 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1189374751 X:40458321-40458343 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1189526448 X:41827373-41827395 ATCTGCTGGTACCTTGATCTTGG - Intronic
1189548854 X:42072378-42072400 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1189793151 X:44622670-44622692 CTCTGCTGATACCTTGATTTTGG - Intergenic
1189815572 X:44821543-44821565 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1189963622 X:46349760-46349782 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1190014751 X:46817387-46817409 ACTTGCTGGCACCTTGATCTTGG - Intergenic
1190163948 X:48056096-48056118 ATCTGCTGGCACCTTGATATTGG - Intronic
1190270831 X:48862034-48862056 AGTTGCTGGTCCCTTGATCTTGG + Intergenic
1190381941 X:49847611-49847633 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1190492583 X:50997725-50997747 GTCTGCTGGCACCTTGATTTTGG + Intergenic
1190511901 X:51181860-51181882 GTCTGCTGGCACCTTGATTTTGG - Intergenic
1190550445 X:51574308-51574330 ATCTGCTAGTACCTTGATCATGG + Intergenic
1191054118 X:56224837-56224859 ATCTGCTGGCACATTGATTTTGG - Intergenic
1191719985 X:64221441-64221463 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1192500762 X:71650233-71650255 AATTGCTGGCACCTTGATCTTGG - Intergenic
1192577130 X:72252007-72252029 ATTTGCCTGCACCTTGATCCTGG - Intronic
1192705075 X:73520712-73520734 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1193136941 X:77982935-77982957 ATTTGCCAGCACCTTGATTTTGG - Intronic
1193797483 X:85893740-85893762 ATCTGCTGGCACCTTGATTTTGG + Intronic
1194189540 X:90817709-90817731 TTTTGCTGGCACCTTGATATTGG + Intergenic
1194307593 X:92267794-92267816 AGATGCTGGTACCTTGATATTGG - Intronic
1194404997 X:93485715-93485737 ATATGCTGGTACCTTGACCTTGG + Intergenic
1194695666 X:97046389-97046411 ATTTGCTGGTGGCATGATTATGG + Intronic
1194752262 X:97698146-97698168 ATCTGCTGGCACCTTAATTTTGG - Intergenic
1194752333 X:97698830-97698852 ATCTGCTGGCACCTTAATTTTGG + Intergenic
1194846198 X:98812224-98812246 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1195116796 X:101707359-101707381 ATTTGCTGGCACCTTGGTCTCGG - Intergenic
1195430333 X:104782058-104782080 ATCTGCTGGCACCTTGATCTTGG + Intronic
1195460037 X:105114268-105114290 ATCTGCTGGCACCTTGATCTTGG + Intronic
1195462773 X:105146073-105146095 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1195513496 X:105745080-105745102 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1195629273 X:107037260-107037282 ATCTGCTGGTATCTTGATCTCGG - Intergenic
1195866463 X:109438166-109438188 ACCTGCTGGTACCTTGATCTTGG - Intronic
1195995407 X:110726448-110726470 ATCTGATGGTACCTTGATCTTGG + Intronic
1196080811 X:111628427-111628449 ATCTGCTGTTGCCTTGATTTTGG + Intergenic
1196577207 X:117333225-117333247 ATCTGCTTGTACCTTGATCTTGG + Intergenic
1197548412 X:127856734-127856756 ACTGGCTGGCACCTTGATTTTGG - Intergenic
1197695382 X:129544182-129544204 AGTAGGTCGTACCTTGATTCTGG + Intronic
1197738108 X:129867808-129867830 ATTGGCTGGCACCTTGATCTGGG - Intergenic
1197925412 X:131642205-131642227 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1198301292 X:135336259-135336281 ATCTGCTGGTGCCTTGATTTTGG + Intronic
1198317181 X:135479776-135479798 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1198499184 X:137225682-137225704 ATCTGCTGGCACCTTGATCTTGG + Intergenic
1198787369 X:140303606-140303628 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1198969504 X:142266043-142266065 ATTTCTTGGTACCCTGATTTTGG + Intergenic
1199049511 X:143220587-143220609 ATCTGCTGGCACCTTGATGTTGG + Intergenic
1199234925 X:145480819-145480841 ATGTGCTGGTACCTTGATCTTGG - Intergenic
1199417265 X:147599587-147599609 ATTGGCTGGCACCTTGATCTTGG + Intergenic
1199695066 X:150338122-150338144 ATCTGCTGGCACCTTGATCTTGG - Intergenic
1199845039 X:151686669-151686691 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1199945440 X:152662353-152662375 CTGTGCTGGCACCTTGATTTTGG - Intergenic
1200536119 Y:4399599-4399621 TTTTGCTGGCACCTTGATATTGG + Intergenic
1200724401 Y:6649171-6649193 TTTGGCTGGGTCCTTGATTCAGG + Intergenic
1201334427 Y:12864813-12864835 ATTTGCTGGTAGCTGGATAAGGG + Intergenic
1201576254 Y:15464659-15464681 AGATGCTTGTTCCTTGATTCAGG + Intergenic