ID: 1013375568

View in Genome Browser
Species Human (GRCh38)
Location 6:109510427-109510449
Sequence CAGAACAACCAGTTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 4, 2: 25, 3: 87, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013375565_1013375568 22 Left 1013375565 6:109510382-109510404 CCAACTGCAGAGAGGATACTCCT 0: 1
1: 0
2: 0
3: 19
4: 120
Right 1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG 0: 1
1: 4
2: 25
3: 87
4: 364
1013375567_1013375568 2 Left 1013375567 6:109510402-109510424 CCTCTCTGCTGATAGCTGGAGAT 0: 13
1: 22
2: 47
3: 260
4: 658
Right 1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG 0: 1
1: 4
2: 25
3: 87
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013375568 Original CRISPR CAGAACAACCAGTTGCAGAG AGG Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
902269955 1:15296708-15296730 CAGAAAAATCAGTGGCCGAGGGG + Exonic
903672100 1:25042603-25042625 CAGGACAACTAGCTGCAGAGAGG - Intergenic
904019813 1:27454730-27454752 AAGAACAAAAAGTTGCAGAAGGG - Intronic
904577396 1:31513951-31513973 TGGCACAACCAGCTGCAGAGAGG - Intergenic
905093479 1:35448652-35448674 CAGCACTGCCAGTTGCACAGAGG - Intronic
905546106 1:38801660-38801682 CGGGACTACCAGTTGCAGAGAGG + Intergenic
906216932 1:44047428-44047450 CAGAAGAACCAGGTCCAGACAGG + Intergenic
907603721 1:55794665-55794687 GGGAACAACCAGTTACAGAGAGG + Intergenic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
909238269 1:73180585-73180607 CAGAACGACCAGCAGTAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
916161879 1:161924911-161924933 CAGAGCAACATGTTGCAGAAAGG - Intronic
916204673 1:162304222-162304244 CTGGACATCCATTTGCAGAGAGG - Intronic
917474426 1:175356079-175356101 CAGAAGAACCAGGTCAAGAGAGG - Intronic
918432566 1:184477225-184477247 CAGAAGAACCATGTGCAGCGTGG - Intronic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919313954 1:195948184-195948206 CAGGACGACGAGTTGCAGAGAGG - Intergenic
919938145 1:202268430-202268452 CAGAATAACCATTTCCATAGTGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097849 1:211902185-211902207 TGGGACAACCAGCTGCAGAGAGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
922861344 1:228818936-228818958 CAGAACAACCATTTGCAGAGAGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924679924 1:246220858-246220880 TGGGACAACCAGCTGCAGAGAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1066693855 10:38060793-38060815 CAGAACCACCAGTTGCTGGCAGG + Intronic
1066998961 10:42588345-42588367 CAGAACCACCAGTTGCTGGCAGG - Intronic
1067018069 10:42772252-42772274 CAGGACAACTAGCTACAGAGAGG + Intergenic
1067715796 10:48690614-48690636 AGGGACAACCAGCTGCAGAGAGG - Intronic
1069613401 10:69790439-69790461 GAGAAAAACCAGGTACAGAGAGG - Intergenic
1069913107 10:71771800-71771822 CAGAGCACCCAGTAGCAGAGAGG - Intronic
1071261155 10:83920321-83920343 CAGAAGAACCAGTAGCAACGTGG - Intergenic
1071886015 10:89951552-89951574 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1072043097 10:91628026-91628048 CAGAACTTCCAGCTGCACAGAGG - Intergenic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1073687339 10:105769761-105769783 CAGAAAATCCAGTAGGAGAGTGG + Intergenic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1073811802 10:107160523-107160545 CAGAACAACTAGAAGCAAAGAGG + Intronic
1074948051 10:118300241-118300263 CTGAAAAACCAGTGGCACAGAGG + Exonic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078315159 11:10288740-10288762 TGGGACAACCAGTTACAGAGAGG - Intronic
1078634305 11:13034534-13034556 AATACCAACCAGTGGCAGAGTGG + Intergenic
1079046115 11:17105208-17105230 AAGATAAACCACTTGCAGAGTGG - Exonic
1079184100 11:18221049-18221071 CAGGACAACCAGCTGTGGAGAGG - Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079710700 11:23679859-23679881 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1080469583 11:32532014-32532036 CAGGACAACCTGTTCCAGTGTGG - Intergenic
1080966982 11:37224643-37224665 CAGAACAATCACCTGCAAAGAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083988638 11:66233166-66233188 CAGACCAAGAATTTGCAGAGGGG + Intronic
1084473507 11:69376378-69376400 CACAACACACAGCTGCAGAGCGG + Intergenic
1084604663 11:70165542-70165564 CAGAACAACCTGTTCGAGATCGG + Exonic
1085100647 11:73797112-73797134 CGGGACAACCGGCTGCAGAGAGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085842988 11:80034962-80034984 GAGAAAAACCAGTCTCAGAGAGG + Intergenic
1086092782 11:83020761-83020783 TGGGACAACCAGTTGTAGAGAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086444901 11:86861526-86861548 CATAATATCCAGTTGGAGAGGGG + Intronic
1087707419 11:101510296-101510318 TATAAAAACCATTTGCAGAGAGG - Intronic
1088513304 11:110599744-110599766 CCTGACAACCAGCTGCAGAGAGG + Intronic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1091329159 11:134717067-134717089 CAGCACACACAGTGGCAGAGAGG - Intergenic
1091334870 11:134758774-134758796 TAGAAGAGACAGTTGCAGAGGGG + Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1093142556 12:15526198-15526220 CAGTACAAGCAGTTACTGAGAGG - Exonic
1093492987 12:19725956-19725978 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1096393861 12:51250469-51250491 AACAACAACCAGGTTCAGAGAGG - Intronic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097298947 12:57997867-57997889 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098192369 12:67963077-67963099 CAGGACAACCACTTGGACAGAGG + Intergenic
1098407956 12:70146644-70146666 CAGAAAAACCAGTCTGAGAGAGG + Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1098545600 12:71707804-71707826 CACAAGAACCAGTTGAAGGGTGG + Intergenic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100672813 12:96835282-96835304 TCGGACAACCAGGTGCAGAGAGG - Intronic
1100847930 12:98679206-98679228 TGGGACAACCAGCTGCAGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101270333 12:103136789-103136811 CACAACAACTAATTGAAGAGAGG - Intergenic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1102328513 12:112010559-112010581 TAGGACGATCAGTTGCAGAGAGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1106308950 13:28535775-28535797 AAGGACAACCAGCTGCAGAAAGG + Intergenic
1106648530 13:31663891-31663913 CAGAACAACCCGATGATGAGAGG - Intergenic
1106925258 13:34606773-34606795 CAGAACAATCAGTTGTAGCCTGG - Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109622177 13:64925229-64925251 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1110796810 13:79647939-79647961 CAGAACAAACATCAGCAGAGAGG - Intergenic
1110939472 13:81330944-81330966 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1111512658 13:89287226-89287248 CAGGACTACTAGCTGCAGAGAGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112342255 13:98562398-98562420 CAGAACAGCCAGTTGCTTATCGG - Intronic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349550 14:21835448-21835470 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1114494037 14:23120361-23120383 CAGAACAAAGAATTGCAGAGAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116131431 14:40859437-40859459 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1118213508 14:63787650-63787672 TGGGACTACCAGTTGCAGAGAGG - Intergenic
1120393565 14:83939262-83939284 CAGAACATGGAGTGGCAGAGAGG + Intergenic
1120590063 14:86364270-86364292 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1122598534 14:102909443-102909465 CACAACAGCCAGTTGAACAGGGG + Exonic
1122624481 14:103077318-103077340 CAAATCACCCAGTTTCAGAGGGG - Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1124937612 15:34187069-34187091 GAGGACAATCAGCTGCAGAGTGG + Intronic
1125420701 15:39501341-39501363 CAGGTCAAGCATTTGCAGAGTGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127864448 15:63020449-63020471 CAGAACAACCATATGAAGGGGGG + Intergenic
1129377708 15:75144733-75144755 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1129656852 15:77530100-77530122 CATCACAACCAGAAGCAGAGTGG - Intergenic
1130083200 15:80753308-80753330 CACAACAGCCAATTGCAGTGTGG + Intronic
1131469541 15:92684211-92684233 GAGAAGACCCAGTTGCTGAGAGG + Intronic
1132305368 15:100807996-100808018 CAGGACAACTGGCTGCAGAGAGG + Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133859097 16:9577098-9577120 GAGAACACACAGATGCAGAGAGG - Intergenic
1134038829 16:11052468-11052490 TAGAACCACCAGCTGCAGGGAGG - Intronic
1134455055 16:14389299-14389321 CACAAAAACAAGTTGGAGAGTGG + Intergenic
1135253006 16:20916758-20916780 GAGAACAAAGAGTTGCAGAGTGG - Intronic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136998894 16:35211369-35211391 CAGAACCACCAGTTGCTGTTGGG - Intergenic
1137256449 16:46778795-46778817 TGGGACAACCAGTTGCACAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138394824 16:56695765-56695787 CAGGACAACCACCTGCAGAAAGG + Intronic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1142808420 17:2383899-2383921 CAGAACTGCCATTTTCAGAGCGG + Intergenic
1143612751 17:8029117-8029139 CACAACAACCAGGAGAAGAGAGG - Intergenic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1144386297 17:14751620-14751642 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1149088728 17:52751668-52751690 CAGGACAATCAACTGCAGAGAGG + Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149884694 17:60328255-60328277 TGGAACAACCAGCTGCAGGGAGG + Intronic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151895179 17:76975168-76975190 CAGGACAGCCGGCTGCAGAGAGG + Intergenic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1152864189 17:82712543-82712565 TGGAACTACCAGCTGCAGAGAGG - Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155830861 18:30513666-30513688 CAGGACAACCAGTAGTAGAGAGG - Intergenic
1155944225 18:31829514-31829536 CATAAGCAGCAGTTGCAGAGAGG + Exonic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157156346 18:45270253-45270275 CAGAAGAACCAGTAGAAAAGTGG - Intronic
1157631381 18:49100624-49100646 TAAAACAACCACTTGCAGAAGGG + Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159519055 18:69495476-69495498 TGGGACAACCAGCTGCAGAGAGG - Intronic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161456728 19:4373332-4373354 CAGAACTCCCAGATGCTGAGGGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1165146308 19:33733062-33733084 AAGACCAACCACTTGAAGAGAGG - Intronic
1166897511 19:46033057-46033079 TGGGACAACCAGCTGCAGAGCGG + Intergenic
1167095898 19:47375040-47375062 CAGAACGACCAAGTGGAGAGAGG - Intronic
1168048923 19:53814245-53814267 CAGAGCAACCACTGACAGAGGGG - Intronic
1168476819 19:56681954-56681976 GAGAACAGGCAGTGGCAGAGGGG + Intergenic
925068235 2:946779-946801 CAGAAAAACTAGTTACAGAATGG + Intergenic
925853024 2:8102020-8102042 AAGACCAACAAGGTGCAGAGAGG - Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927266861 2:21161935-21161957 TAGGACAACCAGCTACAGAGAGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927743155 2:25590569-25590591 TGGGACAACCAGCTGCAGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930273014 2:49278579-49278601 CAGAACAACCTGTTCCAATGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
932376253 2:71238605-71238627 GAGAACAAGGAGTGGCAGAGGGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932921980 2:75926652-75926674 CAGAACATCCAATCACAGAGGGG - Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933930460 2:87145840-87145862 CAGAGGAACAAGTTGAAGAGTGG + Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935187127 2:100744603-100744625 CAGAGCAGCCAGTTTCAGAGGGG - Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936658663 2:114517799-114517821 GTGAACACCCAGCTGCAGAGCGG + Intronic
937474886 2:122206306-122206328 CAGAACACCGAGTTCAAGAGTGG + Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938422091 2:131154131-131154153 CAGAACTAGCAGCTGCACAGAGG - Intronic
940394800 2:153175770-153175792 TAGAGGAACCAGTTACAGAGAGG + Intergenic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940612174 2:156006254-156006276 TGGGACAACCAGCTGCAGAGAGG - Intergenic
941778596 2:169419794-169419816 CAGGACTAAGAGTTGCAGAGAGG + Intergenic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943526307 2:189021053-189021075 CAGGACAACCAACTGCAGAGAGG + Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
944483861 2:200182735-200182757 CGGTACTACCAGCTGCAGAGAGG + Intergenic
944785491 2:203065832-203065854 CATATCAACCAGTTTCTGAGAGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947316719 2:228866690-228866712 TGGGACAACCAGCTGCAGAGAGG + Intronic
948467327 2:238158740-238158762 CAGAACCAGGAGTTGCAGGGGGG + Intergenic
948494187 2:238335881-238335903 CAGAAGAATCACTTGCAGTGAGG - Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948729739 2:239955486-239955508 CAGAATGACCAGTTGCTCAGTGG + Intronic
1169843302 20:9963073-9963095 AAGAACAACCAGATGGGGAGGGG + Intergenic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1170815012 20:19706470-19706492 CAGGACAAGCAGGTGGAGAGAGG + Intronic
1172263402 20:33589260-33589282 GAGAGCAGCCAGTTGCAGAGGGG + Intronic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1172713642 20:36947051-36947073 AAGAAAAACCAGTTGCAAAAAGG + Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175341476 20:58233501-58233523 CATAACCACCAGTGGCAGCGGGG + Intergenic
1175959884 20:62630672-62630694 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1176408452 21:6434535-6434557 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1177357804 21:20031551-20031573 CGGGACAACCAGCTGCTGAGAGG - Intergenic
1178495763 21:33084809-33084831 CAGATCAACCAATTGCAGACAGG + Intergenic
1178769211 21:35487075-35487097 CAGAACAACCAGTCGCCAATGGG - Intronic
1179188314 21:39102374-39102396 CACAACAACCAAATGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1180607306 22:17068428-17068450 CAGAAAAGCCAGTTTCAGTGTGG - Intergenic
1181541473 22:23575232-23575254 CAGCACCAACAGTTTCAGAGAGG - Intronic
1182053332 22:27330131-27330153 CAGCACAATCTGTTGCAGAAAGG + Intergenic
1184613615 22:45622554-45622576 TGGAACAACCAGCTCCAGAGAGG + Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
949218531 3:1600966-1600988 CGGGACAACCAGCTGCAGAATGG - Intergenic
949680841 3:6512667-6512689 GAGGACAACCAGTTGCTGAGAGG + Intergenic
950207626 3:11092694-11092716 CAGTACAGCCAGCTGCAGAGAGG + Intergenic
950644690 3:14369987-14370009 CAGAACAGCAAGTGGCGGAGGGG - Intergenic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
952269331 3:31816906-31816928 TGGAACAACTAGTTGCAGAGAGG - Intronic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
955241469 3:57182407-57182429 TGGGACAACCAGTTGCAGAGAGG - Intergenic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956895210 3:73652955-73652977 GGGAAAAACCAGTGGCAGAGTGG + Intergenic
956989958 3:74751663-74751685 CAGGACAACCAGCCGTAGAGAGG - Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957678787 3:83404565-83404587 CGGAACAACCAGTTGCAGAGAGG + Intergenic
957678804 3:83404673-83404695 TGGGACAACCAGTTGCAAAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
957923099 3:86772345-86772367 CAGAACAACTAGCTGCAGAGAGG + Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959484310 3:106909175-106909197 CAGAGCTACCAGCTGCAGAGAGG + Intergenic
960010429 3:112828877-112828899 AAGCAGAATCAGTTGCAGAGGGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960824950 3:121772728-121772750 CAGAAAAACCTGTCACAGAGAGG + Intronic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961493633 3:127274827-127274849 GGGGCCAACCAGTTGCAGAGAGG + Intergenic
961678942 3:128585714-128585736 CACATCAACCAGTTGCAGCAGGG - Intergenic
962785897 3:138768234-138768256 CAGCACAACAGGGTGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
964791779 3:160460030-160460052 TGGGACAACCAGTTGCAGAGAGG - Intronic
964996792 3:162891871-162891893 CTGGACAACCAGTTACAAAGAGG + Intergenic
965541449 3:169875458-169875480 GGGAACAACCAGCTGCAGAGAGG + Intergenic
965720999 3:171662143-171662165 CAGACCAATCAGCAGCAGAGCGG + Exonic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966205678 3:177403799-177403821 AACAACAGCCAGTTGCAGATTGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
966695823 3:182790014-182790036 TAGAAAAAGAAGTTGCAGAGGGG - Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969392755 4:6902028-6902050 GAGAACAGCCAGCTGCAGTGGGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970774297 4:19654649-19654671 CATAACAGCCAGCTACAGAGTGG + Intergenic
971078063 4:23173388-23173410 CAGGACATAGAGTTGCAGAGTGG - Intergenic
971771366 4:30901285-30901307 CAGAAAAACCAGATAGAGAGAGG + Intronic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972358244 4:38303029-38303051 CAGGACAACCCGCTGCAGAGAGG - Intergenic
972930991 4:44071575-44071597 AAGGACAATCAGCTGCAGAGAGG - Intergenic
974278456 4:59758993-59759015 CAGAACTACCAGCTGCGGAGAGG - Intergenic
974619871 4:64340912-64340934 GGGAACTACCAGCTGCAGAGAGG + Intronic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972976 4:68853897-68853919 CGGGACAACAAGCTGCAGAGAGG - Intergenic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976339447 4:83930237-83930259 AGGAACAACCAGCTGGAGAGTGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976815814 4:89148062-89148084 TGGGACAACCAGCTGCAGAGAGG - Intergenic
977401392 4:96537019-96537041 TAGAACAACCACTTTGAGAGAGG + Intergenic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978545972 4:109873095-109873117 CAGGTCAGCCAGGTGCAGAGTGG - Intergenic
978663402 4:111154468-111154490 CAAGACTACCAGCTGCAGAGAGG - Intergenic
978964530 4:114725370-114725392 TGGAACAACCAGTTGCAGAGAGG - Intergenic
980021179 4:127712058-127712080 CATTACAACCATTTTCAGAGAGG - Intronic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
981960782 4:150536178-150536200 CAGAACAACCAGATACAATGAGG + Intronic
982151412 4:152462122-152462144 CAGACTACCCAGGTGCAGAGGGG - Intronic
984274768 4:177596605-177596627 CAGATCATCGAGCTGCAGAGAGG - Intergenic
986215059 5:5712522-5712544 CAGGACAGTCAGCTGCAGAGAGG - Intergenic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987851411 5:23360726-23360748 CAACACCACCAGTTGCTGAGAGG + Intergenic
987989581 5:25193188-25193210 TAGAACAAGCAGGTGGAGAGAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988518297 5:31923656-31923678 CAGATGAACCTGTAGCAGAGTGG + Intronic
990308212 5:54514549-54514571 CAGGACAGCCAACTGCAGAGAGG - Intergenic
990342793 5:54840418-54840440 GAGAACAAACCCTTGCAGAGTGG + Intergenic
990499952 5:56386133-56386155 CAGTACAATCAGTTGGTGAGTGG + Intergenic
990923459 5:60993770-60993792 CAGGACAACAAGCTGCAAAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
991691755 5:69232208-69232230 CAGAACAACCTGTTTCATTGTGG + Intergenic
991692536 5:69238856-69238878 CAGAATAACAAGTTGCAGGCTGG - Intronic
992057254 5:73002827-73002849 CAGAACAAGAAGTTAGAGAGAGG + Intronic
992748479 5:79841134-79841156 CAGGAAGACCAGTTGCATAGTGG + Intergenic
994851273 5:105057539-105057561 TGAGACAACCAGTTGCAGAGAGG + Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995751358 5:115456428-115456450 CACAACAACCATTTGAAGAAAGG + Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
998227405 5:140337596-140337618 CACAACCAGCAGTGGCAGAGGGG + Intronic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
1000398542 5:160801255-160801277 TGGAACAATAAGTTGCAGAGAGG - Intronic
1002040442 5:176509871-176509893 TAAAAAAACCAGTTGTAGAGCGG - Exonic
1003007239 6:2393169-2393191 CAGAACAACATTTTGCAGAAGGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003718183 6:8670671-8670693 CAAAACAACCAGGTGCAAGGTGG + Intergenic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005775871 6:29130209-29130231 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006133457 6:31882332-31882354 AAGAACATCCAGAAGCAGAGAGG + Intronic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006753788 6:36396839-36396861 GGAAACAACAAGTTGCAGAGAGG + Intronic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1008213572 6:48756662-48756684 GAGAAAAAACAGTTGAAGAGTGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1010813860 6:80331633-80331655 CAGAACAACCGACTGCAGATTGG - Intronic
1011526563 6:88271825-88271847 AAGAAGAACCAGCTGAAGAGAGG + Intergenic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1013693087 6:112668139-112668161 TGGTACTACCAGTTGCAGAGAGG + Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1015267750 6:131306094-131306116 TAGAATAACCAGTTGCAAATTGG + Intergenic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018470197 6:164088959-164088981 CATACCAAACAGTTTCAGAGGGG + Intergenic
1018537546 6:164837546-164837568 CAGAACAATAAGTTTCAGAATGG - Intergenic
1019296066 7:276131-276153 TGGAACAACCAGCTGCAGAGAGG - Intergenic
1020377590 7:7505463-7505485 CAGAACAAAAAGATGCAGATGGG - Intronic
1020812425 7:12863918-12863940 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1021021113 7:15599795-15599817 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021131316 7:16916060-16916082 GAGAACTACAAGTTGGAGAGGGG + Intergenic
1022423406 7:30245787-30245809 CCAGACAACCAGCTGCAGAGAGG - Intergenic
1023624626 7:42103581-42103603 CTGAAGAAATAGTTGCAGAGAGG - Intronic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024333902 7:48184376-48184398 CAGAAAAGCCATTTGAAGAGTGG - Intronic
1025531131 7:61885419-61885441 CAAAATATCCATTTGCAGAGTGG + Intergenic
1025586596 7:62797338-62797360 CAAAACATCCATTTGCATAGTGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029378202 7:100195071-100195093 CCGAATAACCACATGCAGAGGGG + Intronic
1029782112 7:102744771-102744793 CAGGACAACCAGTAGTAGAGAGG + Intergenic
1029973736 7:104814228-104814250 TGGGACAACCAGCTGCAGAGAGG - Intronic
1031008814 7:116502237-116502259 CAGAAGAGCCAGCTGGAGAGAGG - Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031265327 7:119573084-119573106 TAGGACAAACAGCTGCAGAGAGG + Intergenic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1032937282 7:136747612-136747634 AAGAAGAACCAGTTACAGGGGGG - Intergenic
1034210377 7:149358015-149358037 CGGGACAACCAGCTGCAGAAGGG - Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1037185336 8:16056193-16056215 AAAAACAACAATTTGCAGAGGGG - Intergenic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1038834954 8:31109116-31109138 CAGAACTACCAGCTGTAGTGTGG + Intronic
1039351703 8:36770603-36770625 CAGGACAACTGGATGCAGAGAGG + Intergenic
1040571885 8:48618728-48618750 CACAACAACCACTTTCAGAATGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042396090 8:68293040-68293062 CAGTAGAACCAGATGCAAAGAGG + Intergenic
1042687834 8:71461924-71461946 TGGGACAACCAGCTGCAGAGAGG - Intronic
1043299266 8:78706065-78706087 CAAACCAACCAGAGGCAGAGAGG - Intronic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1045239280 8:100384823-100384845 CAAAAGCACCAGTTACAGAGTGG + Intronic
1048116403 8:131528625-131528647 CAAAACACCCAATTGCAAAGTGG + Intergenic
1048222153 8:132551967-132551989 AAGAACAAGCAGATGCTGAGTGG + Intergenic
1048613078 8:136045192-136045214 CAAAAGAACCAGTTTAAGAGAGG - Intergenic
1049021784 8:139961960-139961982 TGGGACAACCAGCTGCAGAGAGG + Intronic
1049156937 8:141073049-141073071 CAGAACAAGCAGTCTCAGTGTGG - Intergenic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1052010465 9:23402020-23402042 CATAACAACCATTTGCAATGAGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1053128216 9:35599719-35599741 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1054902946 9:70388738-70388760 AGGAACAACCAGATGCTGAGTGG - Intronic
1055105570 9:72509039-72509061 CATAACAACTAGTTGGAAAGAGG + Intergenic
1055230454 9:74057986-74058008 CAAGACAATCAGCTGCAGAGAGG + Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056986137 9:91364782-91364804 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056986141 9:91364848-91364870 CAGAACTACCAGCTTCAGAGAGG + Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057327928 9:94083191-94083213 CAGAAACAGCAGTTGCACAGAGG - Intronic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1188756539 X:33969561-33969583 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1188845415 X:35065929-35065951 CAGTATAGACAGTTGCAGAGTGG + Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189124470 X:38431658-38431680 CAGAACAAATATTTACAGAGTGG - Intronic
1190444835 X:50514461-50514483 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190998859 X:55637836-55637858 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1191836487 X:65469215-65469237 CAGAGCAACAAGCTGCAAAGGGG + Intronic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192923520 X:75733347-75733369 AGGAACAACCACATGCAGAGAGG - Intergenic
1192974092 X:76265000-76265022 CTGAACAACCTGTTCCTGAGTGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193640256 X:84003455-84003477 GAGAACAACCAGTAACAGATAGG + Intergenic
1193726884 X:85051472-85051494 TGTAACAACCAGTTGCAGTGCGG - Exonic
1194379386 X:93175347-93175369 CAGAAAATCCAGCTGCAGAGAGG + Intergenic
1194380325 X:93182057-93182079 TGGAAAATCCAGTTGCAGAGAGG + Intergenic
1194380343 X:93182174-93182196 CATGACAGCCAGTTGCAGTGAGG + Intergenic
1195126550 X:101814149-101814171 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1195179028 X:102339197-102339219 CAGGACAATCAGGTACAGAGAGG - Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1199103826 X:143838132-143838154 CAGGACAACCACCTGCAGAGAGG + Intergenic
1199103855 X:143838268-143838290 CAGGACAACCAGCTTTAGAGTGG + Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199534732 X:148889784-148889806 AAGGTCAACCAGTTTCAGAGTGG - Intronic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1199969782 X:152851310-152851332 CCGATCACCCAGTGGCAGAGTGG - Intronic