ID: 1013379830

View in Genome Browser
Species Human (GRCh38)
Location 6:109557310-109557332
Sequence CTCGGTAACATCTTCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013379830_1013379836 2 Left 1013379830 6:109557310-109557332 CCATGCCTGAAGATGTTACCGAG 0: 1
1: 0
2: 2
3: 7
4: 82
Right 1013379836 6:109557335-109557357 GGCTAGAGAGCAGCAAAGATGGG 0: 3
1: 33
2: 118
3: 161
4: 402
1013379830_1013379835 1 Left 1013379830 6:109557310-109557332 CCATGCCTGAAGATGTTACCGAG 0: 1
1: 0
2: 2
3: 7
4: 82
Right 1013379835 6:109557334-109557356 GGGCTAGAGAGCAGCAAAGATGG No data
1013379830_1013379837 21 Left 1013379830 6:109557310-109557332 CCATGCCTGAAGATGTTACCGAG 0: 1
1: 0
2: 2
3: 7
4: 82
Right 1013379837 6:109557354-109557376 TGGGTGCCTGCTCCTTCTTCTGG 0: 51
1: 114
2: 192
3: 568
4: 2283
1013379830_1013379838 22 Left 1013379830 6:109557310-109557332 CCATGCCTGAAGATGTTACCGAG 0: 1
1: 0
2: 2
3: 7
4: 82
Right 1013379838 6:109557355-109557377 GGGTGCCTGCTCCTTCTTCTGGG 0: 49
1: 110
2: 154
3: 181
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013379830 Original CRISPR CTCGGTAACATCTTCAGGCA TGG (reversed) Intronic
913003657 1:114606992-114607014 CCCTGCAACATCTCCAGGCAAGG - Intronic
913524191 1:119675559-119675581 CTGGGTATCATGTTCAGACAGGG - Intronic
917673733 1:177299919-177299941 TTCTGTACCATCTTCAAGCAAGG + Intergenic
920066795 1:203274769-203274791 CTGGTTAACATCTACAGGCCTGG + Intergenic
920221509 1:204406287-204406309 CTCAGTAACTTCTTCAAGGAAGG + Exonic
1064028260 10:11866697-11866719 GTCGATGACATCTTCAGGCTCGG - Exonic
1065451379 10:25862215-25862237 TTCCGTAACCTCTTCAGGGAGGG - Intergenic
1074102396 10:110364149-110364171 CTCGGGAACATATGCAGGAAGGG + Intergenic
1075340554 10:121644185-121644207 CTCGGTACCATCCGCAGCCACGG - Intergenic
1076480025 10:130778919-130778941 AACGGTAACATCTGCATGCATGG + Intergenic
1077991079 11:7413015-7413037 CCTGGTAATATGTTCAGGCATGG + Intronic
1079426151 11:20343500-20343522 CTGAGTGACATCTCCAGGCATGG + Intergenic
1084031345 11:66482436-66482458 CTCGGTAAGGCCTTCAGCCAGGG - Exonic
1085066395 11:73499182-73499204 TTCAGTGACATCTCCAGGCATGG + Intronic
1085381519 11:76123633-76123655 CTATGTAACATCTTCATGCAAGG + Intronic
1086077317 11:82868527-82868549 CTCTGTAATTTCCTCAGGCAGGG - Intronic
1086639477 11:89134388-89134410 CTTGGAAACATATTCAGACATGG - Intergenic
1088805320 11:113347247-113347269 ATCCCTAACATCTTCAGGAATGG - Intronic
1093303394 12:17479937-17479959 CAAGGTGACATCTCCAGGCATGG + Intergenic
1093549818 12:20394788-20394810 CTAAATAATATCTTCAGGCAGGG - Intronic
1094054722 12:26256974-26256996 TTGAGTAACATCTCCAGGCATGG + Intronic
1094408791 12:30147899-30147921 CTTTGTATCATCTTCAAGCAAGG - Intergenic
1096168072 12:49441917-49441939 CTCTGTAACATCTTTGGTCATGG - Intronic
1096204410 12:49708567-49708589 CTAGGTGATAACTTCAGGCATGG - Intronic
1098051446 12:66458264-66458286 CACTGTAACACCTTCAGACATGG + Intronic
1101546538 12:105718719-105718741 CTTGGTAACAACTTTAGCCAGGG + Intergenic
1104237691 12:126955057-126955079 CTGGGTAATATTTTTAGGCATGG + Intergenic
1117507028 14:56414352-56414374 CTCTGTGACATCTTCAGGCAAGG - Intergenic
1127714605 15:61637430-61637452 CTGGGTAACCTCTTCTGGCCTGG - Intergenic
1127864330 15:63019601-63019623 CTCTGATTCATCTTCAGGCAAGG - Intergenic
1132202410 15:99964045-99964067 CTCGGTATCATCTTTAAGCAAGG - Intergenic
1133021718 16:2969819-2969841 CTGGGCAACATCTACACGCACGG + Exonic
1137762047 16:50948811-50948833 CTGGATTACATCTGCAGGCAGGG - Intergenic
1143163409 17:4885732-4885754 CTGGGGAACATCTTACGGCAAGG + Intronic
1146776618 17:35624270-35624292 CTAGGTAAAATGTTCAGGAATGG + Intronic
1146910719 17:36646773-36646795 CTGGGTCACATCTTTAGGGAGGG + Intergenic
1150638869 17:66935930-66935952 CACGGTAACATCTTCTGTAATGG + Intergenic
1153285878 18:3453360-3453382 CTCGGTAACATCATGAGACAGGG - Intronic
1154017192 18:10629139-10629161 CTAGGTAACGTCTCCAGGGAGGG - Intergenic
1159465520 18:68778029-68778051 TGAGGTAACATTTTCAGGCAAGG + Intronic
1165131013 19:33632041-33632063 CTCTGTCACATCACCAGGCAAGG - Intronic
928788035 2:34914368-34914390 CTTGGTAGCAATTTCAGGCAAGG - Intergenic
928944738 2:36762000-36762022 CTCGGTATCACCTTAAAGCAGGG + Intronic
934787593 2:97024900-97024922 CTAGGTAACAACTCCAAGCAAGG + Intergenic
934955014 2:98609748-98609770 CTCGGTAACATCTTCCTAGATGG - Exonic
938097428 2:128472855-128472877 CTCAGCAACACCTTCTGGCATGG - Intergenic
948177753 2:235957522-235957544 CTCTGAAACATCTTCAGAGATGG + Intronic
1170289165 20:14748203-14748225 CTGGGAAACATGTTCAGGAAAGG - Intronic
1175492141 20:59386475-59386497 CTCGGAATCCTCTTCAGGCAAGG - Intergenic
1176223818 20:63982840-63982862 CTTGGTAACATCATCAGGGTAGG + Intronic
1179892357 21:44342659-44342681 CTCAGTTACATCTTCAGACTAGG - Intergenic
950038791 3:9906295-9906317 CTGGGCCACATCTCCAGGCAGGG + Intronic
951784988 3:26407936-26407958 TTCTGTAAAATCTTGAGGCAGGG + Intergenic
952430073 3:33214559-33214581 CCTGGTAATATCTTAAGGCAAGG - Intronic
956838672 3:73117062-73117084 ATCTGTCACATCTTCAGACAGGG - Intergenic
960156767 3:114304600-114304622 CTGGCTAACATCTACTGGCAGGG - Intronic
960894168 3:122484039-122484061 CTCTGTAAAATCTTCAGTCATGG + Intronic
962135962 3:132732406-132732428 CTCGGTAAGATCTTCAGCCATGG + Intergenic
962320470 3:134385958-134385980 CTCGGTAACATCTTTGGTCATGG + Intergenic
962708978 3:138069931-138069953 CTCAGTAACATCTCCAGAGAAGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
965357401 3:167693541-167693563 CTCTGTAACATCTTTGGTCATGG - Intronic
968519104 4:1027756-1027778 GACGGTGACAGCTTCAGGCATGG + Intergenic
969345637 4:6568197-6568219 CGCGGTATCATCTTTAGGCAAGG - Intergenic
970288027 4:14539744-14539766 TTGAGTGACATCTTCAGGCACGG + Intergenic
970302364 4:14694666-14694688 TTTTGTACCATCTTCAGGCAGGG - Intergenic
972573144 4:40328867-40328889 CTACGTAACATCATCAGGGAAGG + Intergenic
979583788 4:122391180-122391202 CTGAGTGACATCTCCAGGCACGG - Intronic
980397460 4:132232943-132232965 CTCCATATCATCTTCAGGAAAGG + Intergenic
984845051 4:184101733-184101755 TTAGGTAACATCTTCACCCAGGG + Intronic
986446956 5:7829784-7829806 CCAGGTAACATCATCAGGCCGGG + Exonic
988177719 5:27748635-27748657 CTGGGTAACATCTAAAGGAAAGG + Intergenic
989676588 5:43981059-43981081 CCAGGTGACATCTCCAGGCATGG - Intergenic
995353406 5:111209393-111209415 CTCTGTAGCATCTTCAATCAAGG + Intergenic
1002416891 5:179125460-179125482 CTGGGAAACCTCTTCAGGCTAGG - Intronic
1007628127 6:43257995-43258017 TTAGGTAACAGCTCCAGGCAGGG - Intronic
1013379830 6:109557310-109557332 CTCGGTAACATCTTCAGGCATGG - Intronic
1019708963 7:2509753-2509775 CTCGGGCAGATCTTCAGGCCTGG - Intergenic
1022298965 7:29084480-29084502 CTAGGTACCACCATCAGGCAGGG - Intronic
1028807097 7:95040383-95040405 CTCCTTAACATCATCATGCATGG - Intronic
1044935881 8:97293006-97293028 CTGGGTAACTTGTTGAGGCAGGG + Intergenic
1047851964 8:128866652-128866674 ATCTGTAACCTCTTCAGTCAAGG - Intergenic
1052420886 9:28241803-28241825 CTGAATAACATCTCCAGGCATGG + Intronic
1052663416 9:31464843-31464865 TTCTGTAACTTCTTCAGGCTGGG + Intergenic
1052801649 9:32973642-32973664 CTCGATCACAGCTGCAGGCAAGG + Exonic
1053780022 9:41598098-41598120 CTGGTTAACCTCTCCAGGCAAGG + Intergenic
1054167979 9:61808341-61808363 CTGGTTAACCTCTCCAGGCAAGG + Intergenic
1054669567 9:67772563-67772585 CTGGTTAACCTCTCCAGGCAAGG - Intergenic
1061877695 9:133553110-133553132 CTCTGTGTCGTCTTCAGGCAGGG + Intronic
1188092263 X:25977582-25977604 TTCAGTGACATCTCCAGGCACGG + Intergenic
1195935145 X:110118248-110118270 ATCAGTAATCTCTTCAGGCATGG + Intronic
1196517179 X:116628089-116628111 TTGAGTAACATCTCCAGGCATGG - Intergenic