ID: 1013380629

View in Genome Browser
Species Human (GRCh38)
Location 6:109566704-109566726
Sequence CTGGAGACTCAGAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013380623_1013380629 17 Left 1013380623 6:109566664-109566686 CCATGTGTATGCAAAGGCATACA 0: 1
1: 7
2: 10
3: 33
4: 246
Right 1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013380629 Original CRISPR CTGGAGACTCAGAAGGGAGC AGG Intronic
No off target data available for this crispr