ID: 1013384661

View in Genome Browser
Species Human (GRCh38)
Location 6:109614192-109614214
Sequence CAACTTTAGCAGCTTGATCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384659_1013384661 20 Left 1013384659 6:109614149-109614171 CCACAAACGTGGGATTAGCAGTT 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1013384661 6:109614192-109614214 CAACTTTAGCAGCTTGATCATGG 0: 1
1: 0
2: 1
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384661 Original CRISPR CAACTTTAGCAGCTTGATCA TGG Exonic
902764457 1:18605338-18605360 CCACTTAAGCAGCCTGAGCAAGG + Intergenic
905542751 1:38773293-38773315 GAAGTTTAGCAACTTGTTCAAGG - Intergenic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
906870585 1:49475641-49475663 CAACTTTGGAAGATTGAACAAGG - Intronic
907333298 1:53685124-53685146 CACCTTTACCTGCTTGCTCATGG - Intronic
909946034 1:81663782-81663804 CATGTTTAGCAGCATGATAATGG + Intronic
910902134 1:92132563-92132585 CAACTTTAGTAGCTTGTTCAAGG + Intronic
912841203 1:113041179-113041201 CCTCTTTGGCAGCTTGATCTTGG - Intergenic
917719293 1:177770924-177770946 TACCTTTAGCAGCTAGATTAGGG - Intergenic
922409772 1:225360763-225360785 CAGCTTTAGCTGCTTGGTCACGG - Intronic
922527043 1:226311987-226312009 CAACATTGGCACCTTGATCTTGG - Intergenic
1063021258 10:2130557-2130579 CAAATTTGACAGTTTGATCATGG - Intergenic
1063808142 10:9671316-9671338 AAACTTTAGTAACTTTATCAGGG - Intergenic
1068917759 10:62451323-62451345 CAAATTGAGCAACTTGAACAAGG - Intronic
1070519850 10:77243164-77243186 CAGCTTTTACAGCTTTATCATGG - Intronic
1070520826 10:77251655-77251677 CAACTTTAACAGCTTCATTGAGG + Intronic
1071344609 10:84680671-84680693 CAGATTTAGCAGCTTATTCAAGG - Intergenic
1072508762 10:96096999-96097021 CAACTTTTACATCTTCATCAGGG - Intergenic
1072747712 10:97953035-97953057 CCACTCTAGCATCTTGCTCAGGG + Intronic
1074347500 10:112701963-112701985 CTACTCTTGCAGCATGATCATGG + Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1078843737 11:15103207-15103229 CCACTTTGGCATCTAGATCAAGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088564888 11:111160179-111160201 CAACTTTTTCAATTTGATCAAGG - Intergenic
1089739585 11:120573301-120573323 CATCTTTAGCATCATGTTCAAGG - Intronic
1089855011 11:121536026-121536048 CACGTTTGTCAGCTTGATCACGG + Intronic
1092982169 12:13807585-13807607 CAAATTAAGCTGCTTGATTACGG + Intronic
1093779407 12:23117687-23117709 AAACTGTAGCACCTTTATCATGG + Intergenic
1095293235 12:40500136-40500158 CAAATTTAGCAAATTCATCATGG - Intronic
1097882643 12:64699969-64699991 GAGGTTTAGCAGCTTGCTCAAGG + Intergenic
1098452752 12:70638687-70638709 CAACTTTAGCAGCAAGATTCTGG + Exonic
1100668060 12:96777321-96777343 CAACTTTTACTGCTTCATCAAGG + Intronic
1100700177 12:97138928-97138950 CAACTTAAGCAGCTAGATACAGG + Intergenic
1102167141 12:110815577-110815599 CAACTCAAGCAACTTGTTCAAGG + Intergenic
1106924435 13:34599376-34599398 CAACTGTAGAAGCTTGGGCAAGG + Intergenic
1110028028 13:70567674-70567696 CATCTTTAGCATTTTCATCATGG - Intergenic
1111889109 13:94059657-94059679 CAAATCTAGCACCTTGATCTTGG - Intronic
1113369137 13:109706552-109706574 CTACCTTAGCAGCTGGACCAAGG + Intergenic
1117941318 14:60968949-60968971 GAACTATAACACCTTGATCAAGG - Exonic
1119712564 14:76832992-76833014 CAACTTTATAAAATTGATCAGGG - Intronic
1120759592 14:88273715-88273737 CACCTTTAGGGCCTTGATCATGG - Intronic
1122049868 14:99049046-99049068 AAACTTTAGAAGCTGGATAAAGG + Intergenic
1124579534 15:30941216-30941238 CAACATGAACAGTTTGATCACGG + Exonic
1135459534 16:22629318-22629340 CAACCCTGGCACCTTGATCATGG + Intergenic
1139123493 16:64048741-64048763 CAACTGTAGCAATGTGATCAAGG + Intergenic
1140460829 16:75138435-75138457 CACCTTCAGCAGGATGATCAAGG + Intergenic
1144077218 17:11730050-11730072 CAACTTTCAGAGCTTCATCAAGG - Intronic
1144965827 17:19076760-19076782 GAACTTTACCAGCTGGATAAAGG + Intergenic
1144982141 17:19175422-19175444 GAACTTTACCAGCTGGATAAAGG - Intergenic
1144986082 17:19202817-19202839 GAACTTTACCAGCTGGATAAAGG + Intergenic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1155751213 18:29423942-29423964 CAAATGTAGGAGATTGATCAGGG - Intergenic
1156077127 18:33292980-33293002 CAAATTTAGCAGCTTGAAACAGG - Intronic
1159129500 18:64265170-64265192 CTACTTTAACAGCTTTATCTTGG + Intergenic
1163561932 19:18024375-18024397 CAACATCAGCAGCTGAATCAGGG - Intergenic
925721453 2:6832206-6832228 CATCTTTAGCAGCTTTATCGAGG - Intergenic
926526405 2:13986682-13986704 CAAATTTATCAGATTTATCATGG + Intergenic
927455935 2:23249357-23249379 CAACTTTGGCAGGCTGGTCACGG - Intergenic
929075136 2:38074569-38074591 CAACTTCAGCAACTTCATCCTGG - Exonic
929750458 2:44706689-44706711 AAACATTAGCAGCTATATCATGG - Intronic
930844828 2:55891805-55891827 CAAGTTTAACATTTTGATCACGG - Intronic
931000559 2:57776110-57776132 CAAATATAGCAACTTGAACAGGG - Intergenic
932539263 2:72634746-72634768 AAACTTCAGCAGTTTGATTAAGG - Intronic
935837184 2:107067772-107067794 CAGCTTTAGCAGCCTGGTGATGG - Intergenic
936314657 2:111414190-111414212 GAACTTAGGCAGCTTGGTCAGGG - Intergenic
938103999 2:128517641-128517663 GAACTTTAGCAACTGGACCAAGG + Intergenic
939496794 2:142935113-142935135 AAACTTCAGAAGCTTGATGACGG - Intronic
941567964 2:167132054-167132076 CAACTTTCAAAGCTTGGTCATGG - Intronic
942918640 2:181344039-181344061 CAAGTTTAGCAATTTGGTCAAGG - Intergenic
943169469 2:184378711-184378733 CAACTTTATCAACTAGATTATGG - Intergenic
944476570 2:200112573-200112595 CAACCTTATCACCTTGACCATGG + Intergenic
945239844 2:207666434-207666456 CAACTTTCTCATCTAGATCAAGG - Intergenic
945262234 2:207854172-207854194 CAAATTTAGCAGAATGGTCAAGG + Intronic
946711942 2:222515633-222515655 CATATTTAACAGCTTTATCAAGG + Intronic
1170790504 20:19505232-19505254 CAACTTCAGCATCATGAACAAGG + Intronic
1172600254 20:36178267-36178289 CAACTCTAGCAGCCAGACCAGGG - Intronic
1174716858 20:52768196-52768218 TCACTTCAGCTGCTTGATCAGGG - Intergenic
1177778952 21:25602328-25602350 GAAGTTCAGCAGCTTGACCAAGG - Intronic
1182656863 22:31897607-31897629 CAACATCAGCTGCTTGCTCAAGG + Exonic
1183756426 22:39770513-39770535 CAAATTTAGAAGCTTGAAGAAGG - Intronic
952261295 3:31742942-31742964 CTACTTCAGCAGCTTGATGGAGG - Intronic
953777256 3:45830923-45830945 CAAGATTTACAGCTTGATCAAGG - Exonic
955017758 3:55088461-55088483 CAACTCCAGCAGCCTGATCAAGG + Intergenic
955429163 3:58824483-58824505 AATCTCTAGCAGCTTGATCATGG - Intronic
955932664 3:64073287-64073309 CAATGTTTGCAGCTTGAGCAGGG + Intergenic
957592052 3:82211793-82211815 CAACTGTAGCACATTGAGCATGG - Intergenic
957760529 3:84549175-84549197 TAACTTTGACAGCTTGATTAAGG + Intergenic
958907513 3:99958393-99958415 CCACTGTAGCAGCTTTTTCATGG - Intronic
959374956 3:105577927-105577949 GAACTTCAGCAACTTGAGCATGG - Intergenic
960950304 3:122994734-122994756 GAGATTTAGCAGCTTGCTCAAGG - Intronic
964734182 3:159899464-159899486 CAGCTTTAGGAACTTGCTCAGGG - Intergenic
965413745 3:168366239-168366261 GAAATTAAGCAGCTTGCTCAAGG + Intergenic
971075340 4:23141506-23141528 TAACTTTAACAGCTTTACCATGG + Intergenic
971660478 4:29407856-29407878 TAAGTTAAGCAGCTTGATGATGG + Intergenic
972480971 4:39495743-39495765 AAGATTTAGCAGCTTGCTCAGGG - Intergenic
976832023 4:89326275-89326297 CAAATATAGCAACTTGAACAGGG - Intergenic
984631674 4:182067339-182067361 AAACTTCAGCAGCTTATTCATGG + Intergenic
986181216 5:5394675-5394697 ACAGTTTAGCAGCTGGATCAGGG - Intergenic
986239557 5:5946694-5946716 CAACTTTTTCAACTTGATAAAGG - Intergenic
987497318 5:18664382-18664404 CATCTTAAGCAACTTGATGAAGG + Intergenic
992481580 5:77157029-77157051 CAGCTTCAGCAGGGTGATCATGG + Intergenic
994032296 5:95157517-95157539 AAACTTTAGCAACTTGTCCATGG + Intronic
995208642 5:109511719-109511741 AAACTTTAGCATATTCATCAAGG - Intergenic
995575990 5:113534816-113534838 TTAATTTAGCAGCTTAATCATGG - Intronic
996416692 5:123218133-123218155 CAACATTAGCAGATAGTTCACGG - Intergenic
996614837 5:125428925-125428947 CAAATTTAGCCCCTAGATCAGGG + Intergenic
997036492 5:130198821-130198843 CTACTTGAGCATTTTGATCAGGG - Intergenic
997300320 5:132798958-132798980 CAACTCTATCAGCTTGGTGATGG + Intronic
999417451 5:151411390-151411412 CAACTATAGGAGATTGATCCAGG + Intergenic
1000349168 5:160339654-160339676 CAACTTTATCAGCGTGTTCCAGG + Intronic
1002974903 6:2064927-2064949 AAAGTTAAGCAGCTTGCTCAAGG + Intronic
1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG + Intergenic
1005303660 6:24494504-24494526 CAACTGAAGAAGCGTGATCACGG + Intronic
1009021314 6:57950666-57950688 ACAGTTTAGCAGCTGGATCAGGG - Intergenic
1010763706 6:79754304-79754326 CAACTTTACCATCTTCAGCATGG + Intergenic
1013384661 6:109614192-109614214 CAACTTTAGCAGCTTGATCATGG + Exonic
1013647372 6:112158621-112158643 CAATTTTACCAGGTTGATTAAGG - Intronic
1015758106 6:136628572-136628594 AAACTTTAGCAGCCTCATCAAGG - Intronic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1021155376 7:17203467-17203489 CATCTTTACCAGCATGAACATGG - Intergenic
1022087660 7:27084603-27084625 CATCTTTAGCTCCTTTATCATGG + Intergenic
1023569050 7:41553570-41553592 CACCTTTACCAGTTGGATCAAGG - Intergenic
1024023755 7:45393859-45393881 GAACTTCCTCAGCTTGATCAAGG - Intergenic
1029314637 7:99700269-99700291 CAACTTAATCAGTTTTATCAGGG + Intronic
1031995949 7:128231051-128231073 GAAGTACAGCAGCTTGATCACGG - Intergenic
1032268825 7:130385895-130385917 CAACTATGGCAGCATCATCAAGG + Exonic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1039383301 8:37106404-37106426 CTAATTTAGCAGCCTGATCCTGG - Intergenic
1041598128 8:59681861-59681883 AAATTGTAGCAGCTAGATCATGG - Intergenic
1044091689 8:88010422-88010444 CAACTTTTGAATCTTGATTAAGG - Intergenic
1048212728 8:132468845-132468867 GAACTTAAGCAGCTGGCTCATGG - Intronic
1049849960 8:144825830-144825852 CAACCTAAACAGCTTTATCAGGG + Intergenic
1055248719 9:74276957-74276979 CAACTGTAGCACCTAGCTCATGG - Intergenic
1056059889 9:82873603-82873625 TAACTTTAGCAGTTTTATTAAGG - Intergenic
1056365397 9:85899603-85899625 CAGCTTGCGCAGCTCGATCAGGG - Intergenic
1058312750 9:103525846-103525868 GAGCTTAAGCAGCTTGCTCAAGG + Intergenic
1058684074 9:107465650-107465672 CAACTTTGGTAGCTTCAACAGGG + Intergenic
1061798692 9:133102862-133102884 CGACTGCAGCAGCTTGATCTGGG + Exonic
1192049615 X:67712093-67712115 CATCTTTAGGAGCTATATCATGG + Intronic
1192220536 X:69194742-69194764 CAAGTTTAGGAGCATGGTCATGG + Intergenic
1197198577 X:123729029-123729051 CAAGTTTATTAGCTTCATCATGG + Intronic
1197310478 X:124899241-124899263 AAAGTTCAGCAGCGTGATCAGGG + Intronic
1198198140 X:134385680-134385702 CAACTTGAGCAGTTTGAAAAGGG + Intronic