ID: 1013384682

View in Genome Browser
Species Human (GRCh38)
Location 6:109614429-109614451
Sequence CAATATGAAAAAATGGAGTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384682_1013384687 27 Left 1013384682 6:109614429-109614451 CCAAACTCCATTTTTTCATATTG 0: 1
1: 0
2: 1
3: 41
4: 431
Right 1013384687 6:109614479-109614501 AGCTGAAATATAACAATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 175
1013384682_1013384686 24 Left 1013384682 6:109614429-109614451 CCAAACTCCATTTTTTCATATTG 0: 1
1: 0
2: 1
3: 41
4: 431
Right 1013384686 6:109614476-109614498 TTCAGCTGAAATATAACAATGGG 0: 1
1: 0
2: 0
3: 18
4: 273
1013384682_1013384685 23 Left 1013384682 6:109614429-109614451 CCAAACTCCATTTTTTCATATTG 0: 1
1: 0
2: 1
3: 41
4: 431
Right 1013384685 6:109614475-109614497 TTTCAGCTGAAATATAACAATGG 0: 1
1: 0
2: 1
3: 20
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384682 Original CRISPR CAATATGAAAAAATGGAGTT TGG (reversed) Exonic
902958511 1:19944172-19944194 CATTATCAAATAAGGGAGTTGGG - Intergenic
903822585 1:26113595-26113617 AAATATGAATAGATAGAGTTTGG + Intronic
904448696 1:30597231-30597253 CAAAATGAAGCAATGGAATTGGG + Intergenic
905097754 1:35488757-35488779 CAGTATGAAATAATGCAGATGGG + Intronic
905935589 1:41821635-41821657 CAATATGTAAAAAGGGATCTGGG - Intronic
906373506 1:45274543-45274565 CAATATAAAAAGAGGGGGTTAGG - Intronic
908133659 1:61103819-61103841 TAATATGAAACTATGGATTTGGG - Intronic
909299834 1:73998300-73998322 AAATGAGAAAAAATGAAGTTAGG - Intergenic
909387577 1:75077056-75077078 CGATTTGAAAAATTAGAGTTAGG - Intergenic
909418281 1:75432656-75432678 CAATATTACAAAATGAAGCTGGG - Intronic
909539892 1:76779606-76779628 CACTGGAAAAAAATGGAGTTTGG + Intergenic
909750585 1:79155766-79155788 CTATAAGAAAAACTTGAGTTAGG - Intergenic
909813618 1:79962167-79962189 CAATATAAAAAAAAGAAGTTTGG + Intergenic
909834440 1:80235919-80235941 AAATACCAAAAAAGGGAGTTAGG + Intergenic
910271078 1:85395374-85395396 CAATATGAAAACGAGGAGATTGG + Intronic
910528631 1:88210390-88210412 CAATGTGATAATATGGAATTAGG + Intergenic
910695979 1:90016245-90016267 CAAGATCACAAAATGGAATTAGG + Intronic
911329173 1:96507207-96507229 CAAGAAGATAAAATGGAGATTGG - Intergenic
911981471 1:104572894-104572916 CAATAAGTAAAAATGCAGTTTGG - Intergenic
912556814 1:110522280-110522302 ACAGATGAAAAAATGGAGTCTGG - Intergenic
913268255 1:117066443-117066465 CCAGATGAAAAAATGGAGGAAGG - Intronic
915198571 1:154209165-154209187 CAAGATGAAAATGTGGAGGTTGG - Intronic
915913902 1:159930102-159930124 CAAGATGAGAAGATAGAGTTTGG + Intronic
915983608 1:160440592-160440614 CACTATTAAGAAATGGGGTTGGG - Intergenic
916209153 1:162344738-162344760 AAATGTGAAAAAATGAAGTATGG + Intronic
916898419 1:169192600-169192622 AAATAAGAAAAAAGGGAGTATGG + Intronic
917983936 1:180295581-180295603 CAAAATGAACAAATGCTGTTGGG - Intronic
918145242 1:181750409-181750431 CAAAACAAAAAAATGGGGTTGGG - Intronic
918290509 1:183103142-183103164 CAAAATGACAAACTGCAGTTGGG - Intronic
919020862 1:192103421-192103443 TAAAATGAAACAATGGAGTCTGG + Intergenic
919094629 1:193016109-193016131 CAATGTCAAATAATGGAATTTGG + Exonic
919502587 1:198356015-198356037 GAATCTGAAATAATGGATTTTGG - Intergenic
920140354 1:203806601-203806623 CATTAAGAAAAAAAGGTGTTAGG - Intronic
921663767 1:217841153-217841175 CAATATGCAGAAATGAAGTAAGG + Intronic
922939761 1:229452170-229452192 CTATAAGAAAAAATGGATTAAGG - Intronic
923056454 1:230429668-230429690 AAATATGAAAAAAAGGAAGTGGG + Intergenic
923243369 1:232107777-232107799 CGATGTGAAAAATTGGAGGTGGG - Intergenic
924063918 1:240205055-240205077 CAATATGTAAAAATCAAGTCTGG + Intronic
924561883 1:245163544-245163566 CAAAAAAAAAAATTGGAGTTAGG - Intronic
1062808459 10:443332-443354 CAATATGAACTCATGGAGTCTGG + Intronic
1063565330 10:7168374-7168396 CAATAAAAAAAAATTTAGTTAGG - Intronic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064056786 10:12104703-12104725 CAAGATGGAAAAAGGGAGCTAGG - Intronic
1065062950 10:21926496-21926518 TGATATGAAAAAATGCATTTTGG - Intronic
1065216087 10:23450125-23450147 GAAGAGGGAAAAATGGAGTTTGG + Intergenic
1065682580 10:28252086-28252108 CAAAATGAAAAGATTGATTTTGG - Intronic
1065930046 10:30471335-30471357 CAAAAAAAAAAAAAGGAGTTTGG - Intergenic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1067260214 10:44683002-44683024 CAAAATGCAAAACTGGACTTAGG - Intergenic
1067913475 10:50371481-50371503 CAATATGAAATAATGAAGTGTGG - Intronic
1068044819 10:51872810-51872832 CCATATGAAATTATTGAGTTTGG + Intronic
1068206091 10:53856093-53856115 AAAGATGATACAATGGAGTTTGG + Intronic
1074011032 10:109480364-109480386 CAATAAGAAATAATAGTGTTTGG - Intergenic
1074951677 10:118342846-118342868 AAATAAGAAAAAAAGAAGTTCGG - Intergenic
1076650625 10:131984561-131984583 CAAAAGGAAGAAATGGATTTAGG - Intergenic
1077833251 11:5898963-5898985 TAATTTGAAAAAATGGCTTTGGG + Intronic
1078288401 11:9981988-9982010 TCATATGGAAAAATGGATTTGGG - Intronic
1079402122 11:20114269-20114291 CAATTTGAAAAACTGGCTTTTGG - Intronic
1079840520 11:25393105-25393127 CAATATGAAAAAACCTAGTCTGG + Intergenic
1080374109 11:31687144-31687166 CCATAGGAAAAGATGCAGTTTGG + Intronic
1080413403 11:32047477-32047499 CAATATGAAGAAATGGCGGAAGG - Intronic
1080459243 11:32438974-32438996 CAATATGAAAAAATCGAGGCTGG + Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1082743412 11:56936448-56936470 CAGTTTGAAAAAATTGAGTTGGG + Intergenic
1083910805 11:65708459-65708481 GAAAATGGCAAAATGGAGTTGGG + Intergenic
1084669836 11:70598671-70598693 CAATATTAGCAAATGGAATTTGG + Intronic
1085012961 11:73154068-73154090 CCATTTGCAAAAATGGAGTTTGG - Intergenic
1085160608 11:74340472-74340494 AAATATGCAAAAATGGAATATGG + Intronic
1085898708 11:80670852-80670874 CTATCTGAAAAAAAGAAGTTGGG - Intergenic
1086847493 11:91769632-91769654 AAAAATGAGAAAATAGAGTTAGG - Intergenic
1087346048 11:96972608-96972630 GTATATGAAACAAAGGAGTTGGG + Intergenic
1087473276 11:98604027-98604049 CAATATCAAAAAAATGTGTTTGG + Intergenic
1087512100 11:99109369-99109391 CCATATGAAAAAATGTACATGGG - Intronic
1088024215 11:105158025-105158047 CACCATGACAAAATGGAGTAAGG - Intergenic
1088320662 11:108551837-108551859 CAATATGACAAAATTATGTTTGG - Intronic
1088404816 11:109462494-109462516 CAATAAGAAAACATGGAGACAGG + Intergenic
1089722356 11:120438734-120438756 AAATAGGAAAAAAATGAGTTTGG - Intronic
1090505599 11:127310237-127310259 CAACATGAAACAGTGGATTTGGG - Intergenic
1091057828 11:132435482-132435504 CAGTGTGGGAAAATGGAGTTAGG + Intronic
1091224471 11:133949447-133949469 CAATATGAAAAAAAGTAATCAGG + Intronic
1092255824 12:6926465-6926487 AAAAAAGAAAAAATGGAGATGGG - Intronic
1092869162 12:12790431-12790453 CATTAATAAAAGATGGAGTTAGG - Exonic
1093119258 12:15248005-15248027 CAATATGAAAATATGTAAATTGG + Intronic
1093236164 12:16610412-16610434 GAATGTGAAAAATTGGAGGTTGG - Intronic
1093792441 12:23268348-23268370 CATTATCAACAAATGAAGTTTGG + Intergenic
1094267290 12:28573568-28573590 CAATAGGATACAATGAAGTTAGG + Intronic
1094404561 12:30102112-30102134 CAATATGCAAAAATGAATTGTGG - Intergenic
1094771220 12:33662400-33662422 CTACATGATAAAATTGAGTTAGG + Intergenic
1095547342 12:43387762-43387784 CAATTTGAAAAAATGAATTGTGG + Intronic
1096262514 12:50101824-50101846 CATTATGCAAGAATGGGGTTTGG + Intergenic
1096344794 12:50836411-50836433 AAGAATGATAAAATGGAGTTTGG + Intergenic
1096935443 12:55268843-55268865 CAATATCAAGAATTGGGGTTTGG + Intergenic
1097536919 12:60883837-60883859 TAATTTAAAAAAATGGATTTTGG - Intergenic
1097969324 12:65615637-65615659 CAACATGAATAAAAGGAGGTGGG - Intergenic
1098046229 12:66403587-66403609 CAATATGAGAAAATCTGGTTTGG + Intronic
1098365167 12:69695092-69695114 CAATACCAGAAAATGGGGTTTGG - Intronic
1098824640 12:75279841-75279863 CTATATGAAAACATAGATTTTGG + Intronic
1098927868 12:76372598-76372620 AAATATGAGAAAGTGAAGTTAGG - Intronic
1098939360 12:76517173-76517195 CAATACATAAATATGGAGTTTGG - Intronic
1099201301 12:79680553-79680575 GCATATGTGAAAATGGAGTTTGG - Intronic
1099217384 12:79869695-79869717 CAATATGAGAAAAAAGACTTAGG + Intronic
1099266907 12:80459107-80459129 TAAAATAAAAAACTGGAGTTGGG - Intronic
1099730573 12:86494928-86494950 CAATGAGAAAGAATGAAGTTGGG + Intronic
1099771509 12:87064546-87064568 CAATATACAAAAATCAAGTTAGG - Intergenic
1099864464 12:88261390-88261412 GAAAAAGAGAAAATGGAGTTTGG - Intergenic
1100061325 12:90579501-90579523 CAAAATGAAATAATAGACTTTGG + Intergenic
1100566845 12:95803817-95803839 TTATATGGAAACATGGAGTTAGG - Intronic
1101030842 12:100657958-100657980 TAATATGAAAAGATGGTGGTGGG - Intergenic
1102493533 12:113303871-113303893 AAAAGGGAAAAAATGGAGTTAGG - Intronic
1103252408 12:119511591-119511613 CAAAAAGAAGAAATGGATTTAGG + Intronic
1104036360 12:125099974-125099996 CAAGAAGAAAAAATGCATTTCGG - Intronic
1104233053 12:126904012-126904034 CAAAATGAAAAGATTGATTTTGG - Intergenic
1105416366 13:20215760-20215782 AAATAGTAACAAATGGAGTTTGG + Intergenic
1106551843 13:30778765-30778787 TAATATTAGAAAATGGAGATAGG + Intergenic
1106930903 13:34663404-34663426 CCATATAAAAAAATGAATTTAGG + Intergenic
1106945189 13:34819888-34819910 TAAGATGAATAAATTGAGTTGGG + Intergenic
1107213200 13:37883840-37883862 CAGTGTGGAAAAATGGTGTTGGG - Intergenic
1107219562 13:37966129-37966151 CAATATGGAAAACTGGATGTGGG - Intergenic
1107291961 13:38864684-38864706 CAAGATGGAAAACTGGAGTTGGG - Intronic
1108101736 13:46964333-46964355 TAATGTGAAAAATTTGAGTTTGG - Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1109301982 13:60599088-60599110 CAATATAAAAAAATGAACTTAGG + Intergenic
1109941481 13:69372212-69372234 TAATTTGGAAAAATAGAGTTAGG + Intergenic
1110277301 13:73654412-73654434 AAACATGAAAAAATTGAGGTTGG + Intergenic
1110768602 13:79308419-79308441 CAAAAAGAAAAAATAGAGATTGG - Intergenic
1111609239 13:90581984-90582006 CAATGTGAAAAATAGAAGTTTGG + Intergenic
1111803891 13:93014326-93014348 GAATATTAAAAAAGAGAGTTTGG + Intergenic
1112718655 13:102216336-102216358 CACTTTGAGGAAATGGAGTTTGG - Intronic
1112780337 13:102893556-102893578 CAATAAAAAAGAATGGAGATAGG - Intergenic
1113063691 13:106353177-106353199 TAATAGGGAAAATTGGAGTTGGG + Intergenic
1113351521 13:109533943-109533965 AAGTATGAAAAAATGGAAGTAGG - Intergenic
1114300854 14:21376060-21376082 CAATGTAAAAGAATGAAGTTGGG - Intronic
1114525224 14:23363937-23363959 AAAAAAAAAAAAATGGAGTTTGG + Intronic
1115513576 14:34162584-34162606 AAATATGAAAGAAAGGAGTTTGG - Intronic
1116145687 14:41065328-41065350 TAAAATGAAAAAATGGAATGGGG - Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116431020 14:44845154-44845176 CAATAGTATAAAATGGAGGTGGG + Intergenic
1117105199 14:52391239-52391261 CAGTATTAAGAAATGGAGTTGGG + Intergenic
1117563081 14:56964935-56964957 AGAGTTGAAAAAATGGAGTTGGG - Intergenic
1118535459 14:66758578-66758600 CAAAATGAAAAAAGGGGGTAAGG + Intronic
1120132745 14:80825719-80825741 CTGTATGAAAAAATGAATTTTGG - Intronic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122523225 14:102361671-102361693 CAAAATAAAAAAATGAAGTTTGG + Intronic
1122582516 14:102779793-102779815 GAAGATGAGAAAATAGAGTTGGG - Intronic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1125365270 15:38907468-38907490 CAATATTAAAAAAACTAGTTGGG - Intergenic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1126298125 15:47165010-47165032 CAATATGGAAGAATGTGGTTTGG + Intergenic
1126466457 15:48965264-48965286 CAGTATGAAAAAATGGCCATTGG + Intergenic
1126900221 15:53307257-53307279 CTATAGGAAGAAATGGAGCTTGG + Intergenic
1126971849 15:54123685-54123707 CAATATCAAAAACAGGAATTTGG + Intronic
1128425644 15:67539755-67539777 CAAGATGAAAATCTGGAGATTGG + Intergenic
1128712781 15:69884690-69884712 CAAGATCAAAAAAAGGAGATGGG + Intergenic
1129300971 15:74625275-74625297 CAAGATAAAAACATGAAGTTGGG + Intronic
1129345253 15:74913617-74913639 TAAGATGAGAAAATGGGGTTTGG - Intergenic
1129347003 15:74928226-74928248 TAACATGAAAAAATAGAATTAGG - Intronic
1130819084 15:87473767-87473789 ATATATGAAACAATGGAGTGTGG - Intergenic
1131130482 15:89896465-89896487 CAATTTGAAAATAAGTAGTTAGG + Exonic
1131414417 15:92241037-92241059 CAAAATGGTAAAATGGACTTTGG + Intergenic
1131436656 15:92428264-92428286 AAATATGAAAAACTGGTGATAGG + Intronic
1133085375 16:3358249-3358271 AAATATGAAAAAAATTAGTTGGG + Intergenic
1133476212 16:6124498-6124520 AAAAAAGAAAAAATTGAGTTAGG - Intronic
1133701407 16:8312703-8312725 CAATATAAAAATATGGATATAGG + Intergenic
1133876079 16:9735757-9735779 CAAGATGAATAAATGGATATTGG + Intergenic
1135929341 16:26723506-26723528 CAATAGAAAAAAATGTAGCTGGG + Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136732715 16:32432313-32432335 AAATCTGAAAAAAAGCAGTTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1137364658 16:47850225-47850247 CAATATAAAAACATAGAATTTGG + Intergenic
1137527839 16:49251747-49251769 CAAGATGATAAACTGGATTTAGG - Intergenic
1138612477 16:58137195-58137217 CAATAAGAAAAAATGGGGCAAGG + Intergenic
1138800647 16:60023861-60023883 CACTATTAAAAAAGGGAATTAGG - Intergenic
1139235565 16:65335015-65335037 AAAGAAGAAAAAATGGAGTTTGG + Intergenic
1139275472 16:65723798-65723820 CAAGAAGAAACAATGGAGTTTGG + Intergenic
1139936238 16:70573298-70573320 CAATTTGATAGAATGGATTTAGG - Exonic
1140243170 16:73223012-73223034 CAATATAAAAAAATGAATCTAGG + Intergenic
1140579242 16:76209538-76209560 CAATATAAATCAATGGAATTGGG - Intergenic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203020367 16_KI270728v1_random:397289-397311 AAATCTGAAAAAAAGCAGTTGGG + Intergenic
1203038702 16_KI270728v1_random:670447-670469 AAATCTGAAAAAAAGCAGTTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1144145548 17:12394458-12394480 CAATAAAAAGAAAAGGAGTTGGG - Intergenic
1145046042 17:19617082-19617104 TGAGATGAAGAAATGGAGTTGGG + Intergenic
1146532736 17:33623761-33623783 AAAGAAGAAAAAATGTAGTTAGG - Intronic
1148449252 17:47764339-47764361 ACATATTAAAAAATGGAGATTGG - Intergenic
1149402793 17:56315780-56315802 CAAAATGAAGAAAGGGAATTTGG + Intronic
1150857048 17:68763284-68763306 CAATATGTAAAAATGAAGCCTGG + Intergenic
1151050072 17:70967980-70968002 CAATATAAACAAATGCTGTTGGG + Intergenic
1151104177 17:71593210-71593232 GAATATGGAAAAAAGCAGTTGGG + Intergenic
1153109800 18:1572181-1572203 CAATATAAAACAAAGGAATTAGG + Intergenic
1153265527 18:3265127-3265149 AAAGTTGAAAAAATTGAGTTTGG + Intronic
1153480141 18:5539927-5539949 CAATAGGAAAAAATGGAAAAAGG - Intronic
1153567398 18:6432043-6432065 CAATATCTAAAACTGGACTTTGG - Intergenic
1153574871 18:6510389-6510411 CAATTTCTAAAAATGGAGTCTGG - Intergenic
1153793593 18:8602304-8602326 AGACATCAAAAAATGGAGTTAGG + Intergenic
1154054244 18:10996034-10996056 CATTTTGAAACAATAGAGTTTGG + Intronic
1154305257 18:13226024-13226046 TAATTTAAAAAAATGGAGATGGG + Intronic
1155100495 18:22605745-22605767 CAATATGAAAAAATGATAGTTGG - Intergenic
1156750146 18:40443280-40443302 TAATATGCAAAAATGTAATTTGG + Intergenic
1157327855 18:46681706-46681728 ACATATGAAAAAATGGAAATGGG + Intronic
1157785596 18:50479293-50479315 AACTCTGACAAAATGGAGTTAGG - Intergenic
1158701489 18:59752384-59752406 AAATATGAAAAAATTTAGATGGG - Intergenic
1159174112 18:64812448-64812470 AAATATGAAAAAAAAGAGTTTGG + Intergenic
1159179511 18:64883693-64883715 AAATATGAATAAATACAGTTGGG - Intergenic
1159476425 18:68926036-68926058 AAATATTAAAAATTGGAATTAGG + Intronic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1160210516 18:76874393-76874415 CAAAAAGACAAAATCGAGTTAGG - Intronic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1165794338 19:38510302-38510324 CAAGAAAAAAAAAAGGAGTTGGG + Intronic
1166602428 19:44109417-44109439 CAGGAAGAGAAAATGGAGTTTGG + Exonic
1167063490 19:47166563-47166585 CTATATGATGAAACGGAGTTGGG - Intronic
930045335 2:47165987-47166009 AAATAAGAAAGAATGCAGTTAGG - Intronic
930099782 2:47594442-47594464 TGATAGAAAAAAATGGAGTTGGG + Intergenic
931975106 2:67635626-67635648 TGACATGAAAAAGTGGAGTTGGG - Intergenic
932237442 2:70131984-70132006 AAATATGTTAAAATGGAGTAAGG + Intergenic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
935639426 2:105276765-105276787 CAACAACAAAAAATGGAGTTGGG - Intronic
935809703 2:106785631-106785653 CATTATGAAAAAATAGATGTTGG + Intergenic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
936729421 2:115361919-115361941 TAATATGAAAATTTGGAGTTGGG - Intronic
937381155 2:121377981-121378003 GAAGATGGAAAAAAGGAGTTTGG + Intronic
937555631 2:123151957-123151979 CAACATGAAGGAATGGTGTTGGG + Intergenic
937947119 2:127350311-127350333 AAAAATGAAACAATGAAGTTAGG + Intronic
938807180 2:134817257-134817279 CTATTTAAAAAAAAGGAGTTGGG + Intergenic
938985785 2:136574714-136574736 CAAAAAAAAAAAATGGATTTGGG - Intergenic
939172893 2:138716160-138716182 CTATTTAAAAAAATGGAGTTCGG - Intronic
939514951 2:143154761-143154783 CAATGAGAAAAAATAGAATTTGG - Intronic
939791280 2:146580639-146580661 TAATATTAAAAAATGGATTCAGG - Intergenic
939897503 2:147809752-147809774 CAATAAAAAAAAATGGGGTGGGG + Intergenic
939939662 2:148334491-148334513 AAATATTAAAAAAAGGAGTCAGG - Intronic
940273644 2:151917166-151917188 CAATATGTATAAACTGAGTTTGG + Intronic
940710542 2:157157854-157157876 CAATTTTAAAAAATTGTGTTTGG - Intergenic
940922728 2:159327761-159327783 CAATAAGAAAATATGAAATTGGG + Intronic
941300874 2:163799576-163799598 GTATATGAAAAAATAGATTTTGG - Intergenic
941415243 2:165212490-165212512 CTATTTTAAAAAATGGATTTTGG - Intergenic
941758020 2:169209478-169209500 GAATAGGAGAAAATGGAGTCCGG - Exonic
943174121 2:184447365-184447387 CAATATTAGAAAATGAAGTTAGG - Intergenic
943248767 2:185490162-185490184 AAATAGGAAAAAATGTAGATAGG - Intergenic
943332891 2:186581279-186581301 CAAACTGAAAAAATGGAATATGG - Intergenic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
943808320 2:192151881-192151903 CAATATGACAAAAGAGAGTTGGG + Intronic
944285413 2:197944003-197944025 CAAGAAGAGAAAATGGATTTAGG - Intronic
946220906 2:218225992-218226014 CAATATGAAAAATAGGAAATAGG + Intronic
1169154693 20:3319600-3319622 CAATATGTGAAAGTGGACTTAGG - Intronic
1172861696 20:38059098-38059120 CAATTCAAAACAATGGAGTTTGG - Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173061471 20:39665731-39665753 CAATATGAAAATATGGACGTGGG - Intergenic
1173572580 20:44087067-44087089 CAATATGATAAAAAGAAGCTTGG + Intergenic
1174055048 20:47792881-47792903 CAATAAAAAAAAAATGAGTTAGG + Intergenic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1174955429 20:55092610-55092632 CAATATCAAAACAAGGAATTTGG + Intergenic
1175312601 20:58022027-58022049 CAATATCACAAAATGTAGTGGGG + Intergenic
1177034203 21:16021670-16021692 CAATATGAAAATAAGGGGTTTGG - Intergenic
1177112507 21:17045634-17045656 TTATATTTAAAAATGGAGTTAGG - Intergenic
1177312870 21:19420032-19420054 CAAAATAAAAAAAGGGAGATTGG - Intergenic
1177397393 21:20555110-20555132 AAATATCAAAAAAAGGAGTCAGG + Intergenic
1177615594 21:23514348-23514370 CAATTTTAAAATATTGAGTTTGG + Intergenic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1178980105 21:37256861-37256883 AAAAATGTAAATATGGAGTTGGG + Intronic
1179530698 21:42016971-42016993 AAATATAAAAAAATAGATTTTGG - Intergenic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180539732 22:16432804-16432826 AAATCTGAAAAAAAGCAGTTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181666442 22:24401729-24401751 CCATTTGAAAAACTGAAGTTAGG - Intronic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1182821724 22:33222380-33222402 CAATATGAAAACATGAAGAATGG - Intronic
949166093 3:942976-942998 TCCTATGAATAAATGGAGTTGGG + Intergenic
949214832 3:1553349-1553371 CAATATGAAAAAAGGAACTGAGG - Intergenic
949605129 3:5644728-5644750 CAATGAGAACAAATGGATTTAGG + Intergenic
949705456 3:6811530-6811552 TAATATGAATAAACAGAGTTGGG + Intronic
951147857 3:19251047-19251069 CAAAATTACAAAATGGAGTTGGG + Intronic
951326944 3:21313771-21313793 CAATATTAAAACTTGAAGTTTGG - Intergenic
953081998 3:39629452-39629474 GAATATGAAACAATGTTGTTGGG - Intergenic
953187364 3:40651358-40651380 GAATATCAAATGATGGAGTTTGG + Intergenic
955472953 3:59305718-59305740 CAAGGGGAGAAAATGGAGTTGGG - Intergenic
955597610 3:60608591-60608613 CACCAGGAAAAAAAGGAGTTGGG + Intronic
955712925 3:61799195-61799217 CAATAGAAAAAACTGGATTTGGG - Intronic
956896389 3:73664975-73664997 AAATATGAAATAATGGAATCTGG - Intergenic
958052047 3:88361005-88361027 AAATATCAAAAAGTGGAGTGGGG - Intergenic
959332046 3:105019114-105019136 CAATTTGGAAATATGGACTTTGG - Intergenic
960025546 3:113004772-113004794 TAAAATGAAAAAATGAGGTTAGG - Exonic
960228047 3:115190282-115190304 AAATATGAAATGATGGTGTTTGG + Intergenic
960274165 3:115708400-115708422 AAAAATTAAAAACTGGAGTTGGG - Intronic
960453827 3:117844771-117844793 CAATAATAATAAATGGATTTGGG + Intergenic
961072673 3:123949656-123949678 TGAAATGAAAAATTGGAGTTGGG - Intronic
961094288 3:124141339-124141361 CAGTATAAAAAAGTGGGGTTGGG - Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962780246 3:138707989-138708011 CATGATGAGAAAATAGAGTTAGG + Intronic
963337294 3:143989908-143989930 CGATCTGAAAAAATGAAATTTGG + Exonic
963816399 3:149836043-149836065 AAATTTTAAAAAATGGAGGTTGG - Intronic
964337095 3:155667114-155667136 CAATTTAAAAATATGGATTTTGG - Intronic
964929428 3:161998604-161998626 CAATACAAAAAAATGGAAATTGG - Intergenic
966260464 3:177972048-177972070 CAATAAGAAAAAAAGGAATATGG + Intergenic
967397992 3:189028200-189028222 CAATATGATTGACTGGAGTTAGG - Intronic
968378519 4:66639-66661 CCATATGAAAAAACTGAGGTTGG - Intronic
968724059 4:2232631-2232653 CAATATGAAAAAATGAAAAATGG - Intronic
970009339 4:11441987-11442009 CAATTTTAAAAAATAGTGTTGGG - Intergenic
970540715 4:17076013-17076035 CAACTTCAAAAAATGGAGTTGGG - Intergenic
970622748 4:17841649-17841671 CAATATGAATATATGAAGTTTGG - Intronic
971245343 4:24922142-24922164 TAAGATGAAATACTGGAGTTGGG - Intronic
971296602 4:25399304-25399326 CAGTATGATAAGATGCAGTTCGG + Intronic
972002347 4:34054851-34054873 CAATAAGAAACAAAAGAGTTGGG - Intergenic
972101503 4:35425718-35425740 AAATATTAAAAAATGTGGTTTGG + Intergenic
972111645 4:35568530-35568552 CAATATGAATAAAGAGAGTTGGG - Intergenic
973724203 4:53756600-53756622 CAATAAAAAGAAATGAAGTTTGG + Intronic
973873991 4:55195912-55195934 CAATAAGAACACATGGAGTCAGG + Intergenic
974563360 4:63552409-63552431 AAATATGAAAACATGAGGTTTGG - Intergenic
974668147 4:64992721-64992743 CAATATGAAAAACTGGGGAAAGG + Intergenic
974928534 4:68332858-68332880 CAATCTGAACAAATGTACTTTGG - Intronic
975123907 4:70760217-70760239 CAAGATGAGAAAATGTAGATGGG + Intronic
975909783 4:79253301-79253323 GAATATAAAAATGTGGAGTTTGG + Intronic
976780721 4:88755817-88755839 CCATTTCAAAAAATGGAGATGGG - Intronic
976911228 4:90308578-90308600 CAATATGCAGAAACTGAGTTTGG + Exonic
979079792 4:116321855-116321877 AAAAATGATACAATGGAGTTTGG + Intergenic
979306710 4:119153909-119153931 CAAAATGGCAAAATGGAGATGGG + Intronic
979420930 4:120504078-120504100 CAAATTTATAAAATGGAGTTTGG + Intergenic
980533895 4:134090087-134090109 CATTAAGAAAAGGTGGAGTTGGG - Intergenic
981205848 4:142039205-142039227 CAATAAGAAATAGTGGAGTTGGG + Intronic
981705636 4:147656451-147656473 CAAAATGAAAAAATTTAGCTGGG - Intronic
983262398 4:165471086-165471108 CAAAATGAAATAAGGGAGTGAGG + Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984640016 4:182153528-182153550 CAGAATGAGAAAATGGACTTCGG - Intronic
985000665 4:185479311-185479333 GAATATGAAAATATGAGGTTAGG + Intergenic
987115907 5:14726529-14726551 CAATATGAAAGACAGGAGCTGGG + Intronic
987214493 5:15719289-15719311 AAAAAGGAAAAAATGGAATTAGG - Intronic
987479127 5:18430660-18430682 AAATATGACAAAATGAATTTTGG + Intergenic
987490335 5:18572617-18572639 CAATTTAATAAAATGGAATTAGG - Intergenic
987619519 5:20322260-20322282 CATTATGAACAATTGGTGTTTGG - Intronic
987778187 5:22396681-22396703 CAATATGACCCATTGGAGTTTGG - Intronic
988211028 5:28203897-28203919 CAATAGAAAAAAATGGTGTCAGG - Intergenic
988344251 5:30017768-30017790 CAACATGGTAAAATAGAGTTTGG + Intergenic
988485941 5:31668160-31668182 CACAATGAAAAAAGGCAGTTTGG - Intronic
989531400 5:42512226-42512248 CAATGTGAGAAAATGGACTCAGG + Intronic
990096149 5:52116423-52116445 AAATATGCCAAAATTGAGTTTGG + Intergenic
990439921 5:55834018-55834040 CAAAATGAAAATATGGGGCTTGG + Intergenic
990456472 5:55994362-55994384 CAAGATGAAAAAACGGCTTTGGG + Intronic
990799997 5:59590300-59590322 AAAAATGAAAAAATGTTGTTGGG + Intronic
990996260 5:61735005-61735027 CAAAATGAAAGTATGGATTTGGG - Intronic
991407592 5:66316706-66316728 AAATAAAAAAAAATGGGGTTGGG - Intergenic
993177919 5:84512501-84512523 CAATATGGAAGAATCTAGTTGGG - Intergenic
993621227 5:90169971-90169993 CAAAATGGAGAAATGGACTTTGG - Intergenic
994034570 5:95184159-95184181 TAATAATAAAAAAAGGAGTTTGG + Intronic
996149652 5:120020032-120020054 CACTCTCAACAAATGGAGTTGGG + Intergenic
996243455 5:121229995-121230017 AAAAAAAAAAAAATGGAGTTGGG - Intergenic
996643799 5:125791385-125791407 CAATCTGAAAGACTGGATTTTGG + Intergenic
996834752 5:127778412-127778434 CAATATCTAAAAATGGATTGAGG - Intergenic
999798637 5:155011591-155011613 AAATATGAGTAAATGGAATTTGG + Intergenic
1000890451 5:166795586-166795608 GAATAAGAAAACTTGGAGTTAGG + Intergenic
1002815916 6:680251-680273 CCATATGAAAAAATTGACCTGGG - Intronic
1004737966 6:18427226-18427248 CACTAGGTAAAAATGGAATTAGG + Intronic
1005422995 6:25672386-25672408 AAAAATTAAAAAGTGGAGTTGGG + Intronic
1005576238 6:27192077-27192099 AAATACAAAAAAATGTAGTTGGG - Intergenic
1007320600 6:41026361-41026383 CATTTTGAGAAATTGGAGTTGGG + Intergenic
1008063277 6:47021100-47021122 CATAAGGAAAAAATGGATTTTGG - Intronic
1008313165 6:50003711-50003733 CAAGATGAAAAACTGGAAATAGG + Intergenic
1008562672 6:52737542-52737564 CAATGGGAAAAAATGGAGAAAGG - Intergenic
1008776164 6:55040512-55040534 TAAAGTGAAAACATGGAGTTTGG + Intergenic
1008877469 6:56345208-56345230 CAATAGGAAACATTTGAGTTAGG + Intronic
1009398068 6:63225416-63225438 TAAAATTAAAAAATGGAGGTTGG - Intergenic
1011413682 6:87093544-87093566 CAACCTGTAAAAATGAAGTTTGG + Intronic
1011669316 6:89667040-89667062 CTATAAGAAAACATGGAATTTGG + Intronic
1012000945 6:93654119-93654141 CAATATGTCAAAATGGTCTTAGG - Intergenic
1012019873 6:93905108-93905130 CAATATCAAGAATTGAAGTTTGG - Intergenic
1012337085 6:98073571-98073593 CAAAATGAGGAAATGGAGTTGGG + Intergenic
1012616786 6:101287089-101287111 CAATATTAAAAAACTGAGCTGGG - Intergenic
1012773214 6:103468134-103468156 CAATGTGAAGAAATGGAGTATGG + Intergenic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1013640943 6:112080396-112080418 CAATTAGTAAAAATGCAGTTAGG + Intronic
1014256531 6:119165797-119165819 TTATATGAAAATTTGGAGTTAGG + Intergenic
1014532184 6:122571464-122571486 CAACATGAAGAAAAGGATTTTGG + Intronic
1016566295 6:145458605-145458627 CATTGTGAGAAAGTGGAGTTTGG + Intergenic
1017193446 6:151677142-151677164 CAAGAAGAAAAATTTGAGTTAGG + Intronic
1017226399 6:152027340-152027362 TAATATCAAAAAATGGGGTTGGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017988337 6:159464150-159464172 TTATATGTAAAAGTGGAGTTGGG - Intergenic
1018646950 6:165957841-165957863 CAATTTGAAACAATTGTGTTTGG + Intronic
1021543318 7:21784844-21784866 TGATATGAAAAATTGGATTTGGG - Intronic
1024434153 7:49329363-49329385 CAATAATATAAAATTGAGTTAGG - Intergenic
1024810010 7:53198909-53198931 CAATATCACAAAATGGCGCTGGG + Intergenic
1024894077 7:54237002-54237024 CAGAATGATAAAATGGACTTTGG + Intergenic
1025909090 7:65813005-65813027 GAACATGAAAAACTGGAGTTTGG - Intergenic
1027760882 7:82277493-82277515 TAATATAAAAAAAGGGGGTTGGG - Intronic
1028313422 7:89368576-89368598 TGAGATAAAAAAATGGAGTTTGG - Intergenic
1028500427 7:91513291-91513313 CAATTTGGAAATCTGGAGTTGGG - Intergenic
1030041733 7:105457501-105457523 CAATAATAAAAAAAGGACTTTGG - Exonic
1030516678 7:110547460-110547482 CAAAATGAAAAAAGTGAGTAGGG + Intergenic
1030532357 7:110727228-110727250 AAATACAAAAAAATGTAGTTGGG + Intronic
1030595696 7:111536273-111536295 CAATATGAAATATTGGTGGTGGG + Intronic
1030854486 7:114536250-114536272 AAATATGATAAAATAGAATTAGG - Intronic
1031431856 7:121681432-121681454 CAATATGAAAAATAGGATTAGGG + Intergenic
1032354392 7:131196290-131196312 CAATATAAGAAAATGCAGCTAGG + Intronic
1032905772 7:136363132-136363154 CAAAATGATAAAATGGACTTTGG - Intergenic
1032924124 7:136583241-136583263 CAATAACAAAAAATGATGTTAGG + Intergenic
1032991913 7:137403241-137403263 CTTTATGAAAAACTGGAATTTGG - Intronic
1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG + Intergenic
1033661599 7:143406813-143406835 CAGTAGGAAAAAACTGAGTTTGG + Intronic
1033921647 7:146400276-146400298 AAATATGAAAAAAAGGAGGCTGG + Intronic
1035384745 7:158463248-158463270 AAATGAGAAAAGATGGAGTTAGG - Intronic
1035778731 8:2210131-2210153 CAATTAGAAAAGATGGAGTTTGG + Intergenic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1038087464 8:24215731-24215753 AAGTATGAAAAGATGGATTTAGG + Intergenic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1039693814 8:39889033-39889055 CAATATCAGAAAATGGAGAAGGG + Intergenic
1041209899 8:55538689-55538711 CATTCTGAAAAAATGCAGCTTGG - Exonic
1041353609 8:56975646-56975668 ATAGATGAAAAAATGGACTTAGG - Intronic
1041631180 8:60089118-60089140 AAATATGAAGAGATGAAGTTTGG + Intergenic
1041656761 8:60359961-60359983 CAGGATGCAAAAATTGAGTTGGG + Intergenic
1041706190 8:60848706-60848728 CAAGATGCAAAAAAGGAGATGGG - Intronic
1042464263 8:69108873-69108895 GCATATGAAAAAATGCAATTGGG - Intergenic
1042644393 8:70969924-70969946 AAAGATGAAACAATGGACTTTGG - Intergenic
1042743005 8:72072233-72072255 CAAAATGACAAACTGGAGTTTGG - Intronic
1043196853 8:77305108-77305130 CAAAATACAAAACTGGAGTTGGG - Intergenic
1043365786 8:79531713-79531735 CAATAAGAAAACATGGACATGGG - Intergenic
1043470745 8:80559782-80559804 CAATATGGAAAAATGGTGGATGG + Intergenic
1044206413 8:89496493-89496515 TCATGTGAAAAAATAGAGTTTGG + Intergenic
1044641925 8:94391883-94391905 CCATAGGAAGAAAAGGAGTTAGG - Exonic
1044700649 8:94962775-94962797 AAAAAAGAAAAAAAGGAGTTTGG - Intronic
1045155973 8:99471741-99471763 CAATATGTAAAAAAGGAGTGTGG - Intronic
1045932636 8:107644950-107644972 CAATATGAAAAATTAGAAATAGG - Intergenic
1046273968 8:111932628-111932650 TACAATGAAATAATGGAGTTGGG - Intergenic
1046547987 8:115675602-115675624 CAATATGAAAGAAAGGAGACAGG - Intronic
1046678180 8:117136120-117136142 CAATAAGAATAACTGGACTTTGG + Intronic
1046725280 8:117667252-117667274 CAAAATGAGAAAAATGAGTTGGG - Intergenic
1046820430 8:118628855-118628877 CACAAAGAAAGAATGGAGTTGGG + Intergenic
1046835996 8:118801814-118801836 AAATATGGAAGAATGCAGTTTGG + Intergenic
1046877122 8:119267685-119267707 TAGTATCAAATAATGGAGTTTGG + Intergenic
1046889146 8:119401877-119401899 CTATATGCAAAAATTAAGTTGGG + Intergenic
1048238074 8:132712214-132712236 AAACAGGAAAAAATGGAGTTGGG + Intronic
1048391319 8:133968217-133968239 AAATATGAGAAAAAGGATTTTGG - Intergenic
1048533488 8:135271854-135271876 CAAAAAAAAAAAATGGATTTGGG + Intergenic
1048602635 8:135934348-135934370 CAATATGAAATAAATGAGATGGG + Intergenic
1050760021 9:9057375-9057397 CATTATGATAAAATGGAGATGGG - Intronic
1052594990 9:30545703-30545725 CAAGAGGAAAAAAAGGAGGTGGG - Intergenic
1053140309 9:35678401-35678423 CAAGACCAAAAAATGGTGTTTGG + Intronic
1053430828 9:38040756-38040778 CAAAATGAAGAAAAGGAGTTTGG + Intronic
1053610491 9:39708601-39708623 CAAAATGATACAATGGACTTTGG + Intergenic
1054087761 9:60762555-60762577 CAAAATGATACAATGGACTTTGG - Intergenic
1054243032 9:62633794-62633816 CAAAATGATACAATGGACTTTGG - Intergenic
1054557156 9:66668312-66668334 CAAAATGATACAATGGACTTTGG - Intergenic
1054924449 9:70575351-70575373 CAGTAGGAAAAAATGAAGTAGGG - Intronic
1056226015 9:84496101-84496123 CAAAAAGAAAAAAAGGATTTTGG - Intergenic
1057365505 9:94416933-94416955 CAATAAGAAAAAAAGGATTAAGG - Intronic
1059861327 9:118466290-118466312 TGATAAGAAAGAATGGAGTTGGG - Intergenic
1203570720 Un_KI270744v1:127611-127633 CCATATGAAAAAACTGAGGTTGG + Intergenic
1185678405 X:1867597-1867619 CAATATGAAAATATGGGGCTGGG + Intergenic
1186103112 X:6177692-6177714 CAACATTAAAAAATGGAAATAGG + Intronic
1186175174 X:6919270-6919292 GAAGATGAAAAAATGGATGTTGG - Intergenic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187723292 X:22174288-22174310 CAAAATGAAAAAATTAAATTTGG - Intronic
1188409131 X:29849899-29849921 CAACATGACAGAATTGAGTTGGG + Intronic
1188564127 X:31505935-31505957 CAAGATGAAAACAGGGAGTCTGG - Intronic
1188573303 X:31615835-31615857 CAATATGTATAAATAGACTTTGG - Intronic
1188681580 X:33014623-33014645 CATCATGAAATTATGGAGTTAGG + Intronic
1188790931 X:34407569-34407591 CAACATTAAAATATGGAGGTGGG + Intergenic
1190307930 X:49096573-49096595 CAATAACAAAAAAAGGAATTAGG - Intronic
1192587276 X:72329046-72329068 CAACATGGAAAAATGGGGATGGG - Intergenic
1193066402 X:77264991-77265013 CAGAAGGAAAATATGGAGTTGGG + Intergenic
1193593382 X:83418505-83418527 CAATAAGAAAAAATATATTTCGG + Intergenic
1194297629 X:92145920-92145942 CAATAAGAAAAAATAAACTTTGG - Intronic
1195451491 X:105018761-105018783 AAATACGAAAGAAAGGAGTTAGG + Intronic
1195631547 X:107060621-107060643 CAATAAAAAAAAATGGAGGCAGG - Intergenic
1196042374 X:111218808-111218830 CAACAGGAAAAAATGGAGACAGG + Intronic
1198098752 X:133405452-133405474 CAGTATTAAATAATGGTGTTTGG - Intronic
1198246484 X:134836906-134836928 CAATAAGAAGAAATTGAGCTGGG + Intronic
1198852214 X:140976897-140976919 CAAAGAAAAAAAATGGAGTTAGG - Intergenic
1200493084 Y:3851980-3852002 CAAAATGAAATAAGGGAGTGAGG + Intergenic
1200615204 Y:5370821-5370843 CAATAAGAAAAAATAAACTTTGG - Intronic
1201180937 Y:11344448-11344470 AAATCTGAAAAAAAGCAGTTGGG + Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic