ID: 1013384786

View in Genome Browser
Species Human (GRCh38)
Location 6:109615860-109615882
Sequence GACTGGTTTATAGTTGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384786_1013384792 -4 Left 1013384786 6:109615860-109615882 CCCCGCTCAACTATAAACCAGTC No data
Right 1013384792 6:109615879-109615901 AGTCACACCTAAGAATGTAGGGG No data
1013384786_1013384791 -5 Left 1013384786 6:109615860-109615882 CCCCGCTCAACTATAAACCAGTC No data
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1013384786_1013384790 -6 Left 1013384786 6:109615860-109615882 CCCCGCTCAACTATAAACCAGTC No data
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384786 Original CRISPR GACTGGTTTATAGTTGAGCG GGG (reversed) Intronic