ID: 1013384786 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:109615860-109615882 |
Sequence | GACTGGTTTATAGTTGAGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013384786_1013384792 | -4 | Left | 1013384786 | 6:109615860-109615882 | CCCCGCTCAACTATAAACCAGTC | No data | ||
Right | 1013384792 | 6:109615879-109615901 | AGTCACACCTAAGAATGTAGGGG | No data | ||||
1013384786_1013384791 | -5 | Left | 1013384786 | 6:109615860-109615882 | CCCCGCTCAACTATAAACCAGTC | No data | ||
Right | 1013384791 | 6:109615878-109615900 | CAGTCACACCTAAGAATGTAGGG | 0: 1 1: 0 2: 0 3: 5 4: 106 |
||||
1013384786_1013384790 | -6 | Left | 1013384786 | 6:109615860-109615882 | CCCCGCTCAACTATAAACCAGTC | No data | ||
Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013384786 | Original CRISPR | GACTGGTTTATAGTTGAGCG GGG (reversed) | Intronic | ||