ID: 1013384787 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:109615861-109615883 |
| Sequence | TGACTGGTTTATAGTTGAGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 127 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 115} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013384787_1013384792 | -5 | Left | 1013384787 | 6:109615861-109615883 | CCCGCTCAACTATAAACCAGTCA | 0: 1 1: 0 2: 0 3: 11 4: 115 |
||
| Right | 1013384792 | 6:109615879-109615901 | AGTCACACCTAAGAATGTAGGGG | No data | ||||
| 1013384787_1013384790 | -7 | Left | 1013384787 | 6:109615861-109615883 | CCCGCTCAACTATAAACCAGTCA | 0: 1 1: 0 2: 0 3: 11 4: 115 |
||
| Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
||||
| 1013384787_1013384791 | -6 | Left | 1013384787 | 6:109615861-109615883 | CCCGCTCAACTATAAACCAGTCA | 0: 1 1: 0 2: 0 3: 11 4: 115 |
||
| Right | 1013384791 | 6:109615878-109615900 | CAGTCACACCTAAGAATGTAGGG | 0: 1 1: 0 2: 0 3: 5 4: 106 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013384787 | Original CRISPR | TGACTGGTTTATAGTTGAGC GGG (reversed) | Intronic | ||