ID: 1013384788

View in Genome Browser
Species Human (GRCh38)
Location 6:109615862-109615884
Sequence GTGACTGGTTTATAGTTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384788_1013384792 -6 Left 1013384788 6:109615862-109615884 CCGCTCAACTATAAACCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1013384792 6:109615879-109615901 AGTCACACCTAAGAATGTAGGGG No data
1013384788_1013384790 -8 Left 1013384788 6:109615862-109615884 CCGCTCAACTATAAACCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81
1013384788_1013384791 -7 Left 1013384788 6:109615862-109615884 CCGCTCAACTATAAACCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384788 Original CRISPR GTGACTGGTTTATAGTTGAG CGG (reversed) Intronic