ID: 1013384790 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:109615877-109615899 |
Sequence | CCAGTCACACCTAAGAATGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 93 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 9, 4: 81} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013384786_1013384790 | -6 | Left | 1013384786 | 6:109615860-109615882 | CCCCGCTCAACTATAAACCAGTC | No data | ||
Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
||||
1013384787_1013384790 | -7 | Left | 1013384787 | 6:109615861-109615883 | CCCGCTCAACTATAAACCAGTCA | 0: 1 1: 0 2: 0 3: 11 4: 115 |
||
Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
||||
1013384785_1013384790 | -5 | Left | 1013384785 | 6:109615859-109615881 | CCCCCGCTCAACTATAAACCAGT | 0: 1 1: 0 2: 0 3: 3 4: 68 |
||
Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
||||
1013384788_1013384790 | -8 | Left | 1013384788 | 6:109615862-109615884 | CCGCTCAACTATAAACCAGTCAC | 0: 1 1: 0 2: 0 3: 10 4: 100 |
||
Right | 1013384790 | 6:109615877-109615899 | CCAGTCACACCTAAGAATGTAGG | 0: 1 1: 0 2: 2 3: 9 4: 81 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013384790 | Original CRISPR | CCAGTCACACCTAAGAATGT AGG | Intronic | ||