ID: 1013384790

View in Genome Browser
Species Human (GRCh38)
Location 6:109615877-109615899
Sequence CCAGTCACACCTAAGAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384786_1013384790 -6 Left 1013384786 6:109615860-109615882 CCCCGCTCAACTATAAACCAGTC No data
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81
1013384787_1013384790 -7 Left 1013384787 6:109615861-109615883 CCCGCTCAACTATAAACCAGTCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81
1013384785_1013384790 -5 Left 1013384785 6:109615859-109615881 CCCCCGCTCAACTATAAACCAGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81
1013384788_1013384790 -8 Left 1013384788 6:109615862-109615884 CCGCTCAACTATAAACCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1013384790 6:109615877-109615899 CCAGTCACACCTAAGAATGTAGG 0: 1
1: 0
2: 2
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384790 Original CRISPR CCAGTCACACCTAAGAATGT AGG Intronic