ID: 1013384791

View in Genome Browser
Species Human (GRCh38)
Location 6:109615878-109615900
Sequence CAGTCACACCTAAGAATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013384786_1013384791 -5 Left 1013384786 6:109615860-109615882 CCCCGCTCAACTATAAACCAGTC No data
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1013384785_1013384791 -4 Left 1013384785 6:109615859-109615881 CCCCCGCTCAACTATAAACCAGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1013384787_1013384791 -6 Left 1013384787 6:109615861-109615883 CCCGCTCAACTATAAACCAGTCA 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1013384788_1013384791 -7 Left 1013384788 6:109615862-109615884 CCGCTCAACTATAAACCAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1013384791 6:109615878-109615900 CAGTCACACCTAAGAATGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013384791 Original CRISPR CAGTCACACCTAAGAATGTA GGG Intronic