ID: 1013387081

View in Genome Browser
Species Human (GRCh38)
Location 6:109642409-109642431
Sequence ACTAGGGAATTAATCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013387081_1013387084 -10 Left 1013387081 6:109642409-109642431 CCTTCACTGATTAATTCCCTAGT 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1013387084 6:109642422-109642444 ATTCCCTAGTTCATTCTGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013387081 Original CRISPR ACTAGGGAATTAATCAGTGA AGG (reversed) Intronic
906580572 1:46932319-46932341 ACTAGTGAATTAAATAGGGAAGG + Intronic
906603150 1:47146573-47146595 ACTAGTGAATTAAATAGGGAAGG - Intronic
907430928 1:54410820-54410842 ACTAGGCTATTAGTCAGTGTTGG + Intronic
912125591 1:106533334-106533356 ATGAGGGAATTAATCTATGAGGG + Intergenic
913441725 1:118905613-118905635 TCTATGGAAGTAATCAGTGCTGG - Intronic
915758151 1:158283100-158283122 CCTAGGGATTCAATTAGTGATGG + Intergenic
916554841 1:165885403-165885425 TCTATGGAACAAATCAGTGAAGG - Intronic
919826000 1:201503650-201503672 ACATGGGAATTACTCAGTGCTGG + Intronic
921285317 1:213604372-213604394 AATAGGGGATTAATACGTGATGG - Intergenic
923884828 1:238142861-238142883 ACTAGTTATTTAATGAGTGAGGG + Intergenic
924030781 1:239883233-239883255 ACTAAAGAATAAATAAGTGATGG - Intronic
1068729266 10:60338096-60338118 ACTCGGGAAGAAATCAGAGATGG - Intronic
1074206200 10:111285055-111285077 AGTAGGCACTCAATCAGTGAGGG - Intergenic
1075279200 10:121125225-121125247 ACTAGGGCAATAATCACTGTTGG - Intergenic
1079364316 11:19796090-19796112 ATTAGGGAATTCATCAATGGGGG + Intronic
1079514643 11:21252639-21252661 AATTGGGAATTAATCAGAAATGG + Intronic
1080418203 11:32089167-32089189 ACATGGGAATCAATCAGGGAAGG - Intronic
1080481482 11:32655714-32655736 AATGGGGAATTAACCACTGAAGG + Intronic
1080859571 11:36141614-36141636 AGTAGGGAATCAGTCAGTAAAGG + Intronic
1081840199 11:46194837-46194859 ACGAGGTAAGTACTCAGTGAAGG - Intergenic
1086036884 11:82426659-82426681 ACTAGAGAAGAAATAAGTGAAGG + Intergenic
1088322080 11:108564602-108564624 TCTAAGGAATTAATCAGAGATGG - Intronic
1088364836 11:109029902-109029924 ACTAGGGAAGTAATCAAGGCTGG + Intergenic
1093189871 12:16061533-16061555 AATGAGGATTTAATCAGTGATGG + Intergenic
1093473557 12:19530934-19530956 AGTAGAGAAGGAATCAGTGAAGG - Intronic
1094128003 12:27043970-27043992 ACCAGGGAAATAATCACTGATGG + Intronic
1094256606 12:28436558-28436580 ACTAGAGAAGTAATAAGTGTAGG - Intronic
1094436153 12:30422925-30422947 ACTAGACAATTATTTAGTGATGG - Intergenic
1095317779 12:40786720-40786742 ACAAGGGAAAGCATCAGTGAAGG + Intronic
1096203090 12:49700024-49700046 CCTAAGGAAATAATCAGAGATGG + Intronic
1098198130 12:68024026-68024048 CCTAAGCAATTAATCAGTGGTGG - Intergenic
1098603737 12:72364653-72364675 ACAAGAGAGATAATCAGTGAAGG + Intronic
1099100037 12:78427956-78427978 ACTAGGGCTTTAATCTGTCAGGG - Intergenic
1099307024 12:80970355-80970377 ATTAGGCCATTGATCAGTGATGG + Intronic
1100403826 12:94255469-94255491 ATTAGGGTATAAAACAGTGATGG + Intronic
1102721997 12:115024353-115024375 ACTAGGAGGTTAATCAATGAAGG + Intergenic
1104139883 12:125977537-125977559 ACTAGGGAATAAAACATTGTAGG - Intergenic
1104637851 12:130449237-130449259 ACTTGGGAATTCATCAGCCAGGG - Intronic
1105916324 13:24920163-24920185 ACAGGGGAATGAATCAGCGAGGG - Intronic
1110301982 13:73939195-73939217 ACTTAGGAAATAAACAGTGAGGG + Intronic
1119333478 14:73813163-73813185 TCTAGGGAAATAATCAGTCTAGG + Intergenic
1126269688 15:46800064-46800086 GATATGGAATTAAGCAGTGAGGG - Intergenic
1133124338 16:3635503-3635525 ATTAGAGAATAAATAAGTGAAGG - Intronic
1133332577 16:4984413-4984435 ATGAGGGAATAAATCAGTGGTGG - Intronic
1133465568 16:6023909-6023931 ATTAAAGAATCAATCAGTGATGG + Intronic
1138101346 16:54254481-54254503 AGTAGGGGATTAATAAGTGGGGG + Intronic
1139741374 16:69037890-69037912 AGTATCTAATTAATCAGTGATGG - Intronic
1140806156 16:78533998-78534020 ACTAGAGGATGAATGAGTGATGG + Intronic
1142579110 17:929979-930001 ACTTTGGAATCAATCAATGACGG + Intronic
1146833068 17:36086896-36086918 AGTAGGGGATTAATCAGTAGAGG - Intergenic
1149503902 17:57177106-57177128 ACAAGGGAAATTTTCAGTGATGG - Intergenic
1151930967 17:77231053-77231075 ACTAGGTAATTTATCAGCCAGGG - Intergenic
1154413698 18:14160241-14160263 ATTTAGGAATTAATCAATGAGGG + Intergenic
1156570541 18:38247177-38247199 ACTAGAAAATTAAGCAGAGATGG - Intergenic
1156918527 18:42489998-42490020 ACTAGGGTGTTATTCTGTGAAGG - Intergenic
1160541382 18:79625526-79625548 ACCTGGGAATTAATCACTCACGG - Intergenic
1162693885 19:12456670-12456692 TCTAGGGCTTTAATCACTGAGGG - Intronic
925650241 2:6081642-6081664 ACGAGGGATTTAATCTTTGATGG - Intergenic
928341925 2:30450568-30450590 AATATGGAAGTAATCACTGATGG + Intronic
930166782 2:48210873-48210895 AGTAGGGACTTAATAAGTGTTGG + Intergenic
931017302 2:57998087-57998109 ATTAGGGAAGTAATAACTGAAGG + Intronic
933184899 2:79268042-79268064 ACAAAGGAAATAATTAGTGAGGG + Intronic
934752619 2:96803264-96803286 AGTGGAGAATTAATCAATGAGGG - Intronic
935263146 2:101371885-101371907 CCTGGGGAATAAATCGGTGAGGG + Intronic
943760485 2:191602494-191602516 ACAAGGGACTTAATAAATGATGG + Intergenic
945746976 2:213730225-213730247 ACTAGGGAAAGACTCAGTTAAGG + Intronic
1169828521 20:9796560-9796582 AGTAGGAAATTACTAAGTGAAGG + Intronic
1170930432 20:20765001-20765023 ATTAGAGCATTAATTAGTGATGG + Intergenic
1170933047 20:20786169-20786191 AGTAGGCAATTAAACAATGATGG + Intergenic
1172765844 20:37350309-37350331 ATTAGGGACTCAATCAGTGGAGG + Intronic
1173159512 20:40641970-40641992 ACTGGGGAATCAATCACTGGGGG - Intergenic
1174177278 20:48652987-48653009 ACCAGTGAATCAATCAATGAGGG + Intronic
1174677099 20:52369017-52369039 ATGAGGGAATAAATTAGTGAAGG + Intergenic
1178990414 21:37350504-37350526 ACTAGGGAATGAATGCATGAAGG - Intergenic
953151806 3:40331983-40332005 GCTAGGGAAATAATCAGAGATGG + Intergenic
953366140 3:42346867-42346889 ACAAGGGTTTTAATCAGTAATGG + Intergenic
955908428 3:63832268-63832290 TCTAGTGAATTAATCAATGGGGG + Intronic
958490865 3:94770631-94770653 ACTGGAGAATAAATAAGTGAAGG + Intergenic
959232776 3:103677486-103677508 TCTAGGGAAATTATTAGTGAAGG + Intergenic
960628628 3:119705364-119705386 ACTAGGGAACTAATCACATAGGG - Intronic
964289929 3:155166766-155166788 ACCATGGCATTATTCAGTGATGG - Intronic
965076706 3:163988648-163988670 ACTAGGGATTCAATCTGTGAGGG + Intergenic
965197641 3:165621837-165621859 ACTAGGGCATTAGTCAAAGAAGG - Intergenic
967542693 3:190686536-190686558 ACTAATGAATGAATTAGTGAAGG + Intergenic
970314732 4:14818302-14818324 CCTAGGGAATCAATAAGTGATGG + Intergenic
971379919 4:26087252-26087274 GCTAGGGAAATAATCGGTGCAGG + Intergenic
976890758 4:90044718-90044740 ACTAGAGAATTAATGAATTAAGG + Intergenic
978173876 4:105706730-105706752 AGTAGGGAAAGACTCAGTGAAGG - Intronic
981649805 4:147043891-147043913 ACGGGGGCATTACTCAGTGAGGG + Intergenic
984748953 4:183253234-183253256 ACTAGGGCATTAGTAAGTCAGGG - Intronic
987225172 5:15832367-15832389 ACTAGGGAATAAATCAAGCAAGG + Intronic
987419888 5:17707193-17707215 ACTATGAAATTAATCTGAGAGGG + Intergenic
988721339 5:33882033-33882055 AGATGGGAATTAATCCGTGAGGG + Intronic
990737614 5:58881063-58881085 ACTGTGGAATGAATGAGTGAAGG - Intergenic
992362197 5:76050530-76050552 ACTAAGGAACAAATGAGTGAAGG - Intergenic
997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG + Intronic
997188977 5:131912591-131912613 ACTATTCAATTAATCAGTGTAGG - Intronic
998297495 5:140985722-140985744 AAAAAGGAATTCATCAGTGAAGG - Intronic
999492480 5:152064750-152064772 TCTGGGGAATCAATGAGTGAAGG - Intergenic
999848741 5:155514482-155514504 ACTAGGGGATGAATCAGGGGTGG - Intergenic
1001049873 5:168405583-168405605 CCCAGGGAAGTAATCAGGGAAGG + Intronic
1001500925 5:172233243-172233265 ACTAGGGATTAAAACAATGAAGG + Intronic
1003751244 6:9059413-9059435 CCAAGGGAATTAATAACTGATGG + Intergenic
1004412460 6:15393423-15393445 ACAAGAGAATTACTCAATGATGG - Intronic
1005653861 6:27912036-27912058 ACCAGGAAAGTAATCAGTTATGG - Exonic
1007234970 6:40384041-40384063 ATTAGGGAACCAATGAGTGAGGG + Intergenic
1007240287 6:40419950-40419972 ACTAGGTCATTAGTCAGTAATGG - Intronic
1007904838 6:45449062-45449084 AACAGGGAATTAATCTGTAAGGG + Intronic
1010360276 6:74985629-74985651 TCTAGGAAATTAATCTTTGAAGG - Intergenic
1010911158 6:81558541-81558563 ATGAGGGAATAAATAAGTGAAGG + Intronic
1012144425 6:95664086-95664108 CCTTGGAAAGTAATCAGTGAAGG - Intergenic
1013387081 6:109642409-109642431 ACTAGGGAATTAATCAGTGAAGG - Intronic
1013574156 6:111464019-111464041 TTTAGTGATTTAATCAGTGATGG - Intronic
1014098082 6:117482190-117482212 ATGAGTGAATAAATCAGTGAAGG + Intronic
1016072537 6:139757216-139757238 ACGAGGGAACTAAGTAGTGAGGG + Intergenic
1019403667 7:870763-870785 CCACGGGAATTAATTAGTGAAGG - Intronic
1020898181 7:13969335-13969357 ACTAGGGAATCAAAAAGCGAAGG - Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1020926158 7:14327831-14327853 AATAATGTATTAATCAGTGATGG - Intronic
1024434497 7:49334309-49334331 ACCAGGGAATCAAATAGTGAGGG - Intergenic
1029179097 7:98686487-98686509 ACAAGTGAATGAATGAGTGAAGG + Intergenic
1033764470 7:144473143-144473165 ACTCAGGAAATAATCAGTAATGG - Intronic
1035808096 8:2470257-2470279 ACGAGGACATTTATCAGTGAGGG - Intergenic
1037109844 8:15153199-15153221 ACAAGAGAATTAATCCCTGATGG - Intronic
1038282380 8:26177739-26177761 ACCAGGGATGTAGTCAGTGAAGG + Intergenic
1038753049 8:30314729-30314751 ACTAGGAAACTAATCATTAAAGG - Intergenic
1039006809 8:33047632-33047654 ACTAAGGAAATTATCAGAGAGGG + Intergenic
1040007282 8:42631064-42631086 ACTAGGGAATTAAAGAGAAAGGG - Intergenic
1040873136 8:52121328-52121350 CTCAGAGAATTAATCAGTGAAGG + Intronic
1042810096 8:72815632-72815654 ATTTGGGAGTTAGTCAGTGAAGG - Intronic
1046389329 8:113547957-113547979 AATAGTGAGTAAATCAGTGAAGG - Intergenic
1048627329 8:136199649-136199671 ACTCGGGAAACAGTCAGTGAAGG + Intergenic
1049299920 8:141864040-141864062 ACTTGGGAATTAGTCAGGGAAGG + Intergenic
1051259620 9:15250279-15250301 TCTAGATAATTAAACAGTGATGG - Intronic
1051530408 9:18095721-18095743 ACTAAGAAATTTATCAGGGAGGG - Intergenic
1051895916 9:21989275-21989297 CCTTGGGAATTAATAAATGAAGG - Intronic
1052593182 9:30525253-30525275 ACTAGGGAAAACATCAGAGAAGG + Intergenic
1052756119 9:32543627-32543649 ACCAGGGGACTAATCTGTGAAGG + Exonic
1058511345 9:105721776-105721798 ACTAGAGAATTGTTCAGTAATGG - Intronic
1059486058 9:114627628-114627650 ACCAGGGAATGAATCAATGCTGG - Intronic
1060469646 9:123937531-123937553 ATTAATGAATAAATCAGTGAAGG - Intergenic
1186371926 X:8955556-8955578 GTTAGGGAACTAACCAGTGACGG + Intergenic
1189183251 X:39024792-39024814 ACAAAGGAAATAATAAGTGAAGG - Intergenic
1189607556 X:42695832-42695854 AGCAGGGAAATAATAAGTGAGGG + Intergenic
1192824608 X:74682159-74682181 CCTGGGGAATGACTCAGTGATGG - Intergenic
1193151241 X:78126879-78126901 ATTTGGGAATGAATCACTGATGG - Exonic
1196418833 X:115502081-115502103 ACTGGAGAATGAATAAGTGAAGG - Intergenic
1197597027 X:128477310-128477332 ACTATGGAATTCATTAGTTAAGG + Intergenic
1199391895 X:147289957-147289979 AGTAGGGATGTAATCTGTGATGG + Intergenic
1202036739 Y:20644111-20644133 ACGAGGGAAGTGACCAGTGATGG + Intergenic