ID: 1013390982

View in Genome Browser
Species Human (GRCh38)
Location 6:109686228-109686250
Sequence GTGTCTTTATAAGGGGATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013390982_1013390987 24 Left 1013390982 6:109686228-109686250 CCCGGATCCCCTTATAAAGACAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1013390987 6:109686275-109686297 GATAAACCTACAAAGTTTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013390982 Original CRISPR GTGTCTTTATAAGGGGATCC GGG (reversed) Intronic
905632671 1:39527391-39527413 GTGTCATTAAAAGCAGATCCTGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906770425 1:48478603-48478625 TTGTCTTTATAAGTTAATCCTGG + Intergenic
907616620 1:55933224-55933246 ATGGCTTTATCAGGGGTTCCTGG - Intergenic
907697852 1:56752074-56752096 GTGTCCTTATAAGGGTAGCAAGG + Intronic
909477681 1:76099217-76099239 GTTTCTCTTTAAGGTGATCCTGG + Intronic
913435255 1:118840994-118841016 GTGCCCTTATAAAGAGATCCAGG - Intergenic
916668729 1:166991456-166991478 TTGTCTTTAAAAGGTGATCAAGG + Exonic
916902928 1:169249675-169249697 GTTTTTTTATACGGGGATGCTGG + Intronic
922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG + Intergenic
923976630 1:239271473-239271495 ATGGCTTTATCAGGGGATCAGGG + Intergenic
1065188535 10:23191668-23191690 GTGTCATTGGAAGGTGATCCGGG - Intergenic
1069969658 10:72155730-72155752 GTTTCTTTATTAAGGGGTCCAGG - Intronic
1071328946 10:84541819-84541841 GTGTGCTTATTATGGGATCCAGG - Intergenic
1071938048 10:90552267-90552289 GTCTCTTTATGTGTGGATCCTGG - Intergenic
1072089397 10:92112445-92112467 GTTTCTTTACAAGAGGAACCTGG - Intronic
1072408604 10:95178783-95178805 GTGTATTTATAAAGGTATCTAGG - Intergenic
1072413318 10:95225971-95225993 GTTTCTTTATAATGAGATCCAGG + Intronic
1073917208 10:108419351-108419373 GTGTTTTAATAATTGGATCCAGG - Intergenic
1074693810 10:116029965-116029987 GTGTCTTGATAAGAGAAGCCAGG + Intergenic
1075355301 10:121766991-121767013 CTGTGTTCATAAGGGGATACTGG - Intronic
1075798856 10:125140010-125140032 GTGTCTTTATTAAGGGTTCAGGG - Intronic
1076533820 10:131163113-131163135 GTGTCTTACCAGGGGGATCCGGG + Exonic
1084404284 11:68962034-68962056 GCGTCCTTATAAGGGGAAGCAGG + Intergenic
1088883871 11:113992297-113992319 ATGTCTTTATAAGTGCTTCCGGG + Intergenic
1089301734 11:117503032-117503054 GTGTCTGTATAATGGATTCCTGG - Intronic
1089427607 11:118392797-118392819 GTGTGCTCATAATGGGATCCAGG - Exonic
1090565260 11:127984376-127984398 GTGTCTTTATAAGGGAAGTTAGG + Intergenic
1094753888 12:33443678-33443700 GTGTTTTTAAATGGAGATCCAGG - Intergenic
1098446574 12:70572020-70572042 GTGACTATTTAAGGGTATCCTGG - Exonic
1110822710 13:79934969-79934991 GAGTCTTGAGAAGGGGATCCAGG - Intergenic
1111928329 13:94486589-94486611 ATGTCATTTTATGGGGATCCAGG + Intergenic
1112390877 13:98983066-98983088 CTGTCTTTATTAGGGGTTCTTGG + Intronic
1114008621 14:18342334-18342356 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1115643854 14:35352987-35353009 GTGTCTGTATATGTGGTTCCTGG - Intergenic
1118730048 14:68659637-68659659 GTGTCTTTGAAAGGAGATTCTGG + Intronic
1120677263 14:87434934-87434956 GTTTCTTTTTAAGTGGTTCCTGG - Intergenic
1123391830 15:19882906-19882928 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1129161445 15:73750250-73750272 CTGTCTTTCTAAGTGGAGCCTGG - Intronic
1130974416 15:88762304-88762326 GTGACTTTAGAAGGGAAGCCAGG + Intergenic
1136244143 16:28963701-28963723 GGGTCTTTAGAGGGGAATCCTGG - Exonic
1141729439 16:85811940-85811962 CTGTCTTTACATGGGGATTCAGG - Intergenic
1144215326 17:13050217-13050239 GTGTCCTTATAAGGGGTTCTCGG - Intergenic
1151041493 17:70866221-70866243 TTGTCTTTGTAATGGTATCCTGG - Intergenic
1152449383 17:80367079-80367101 GTGTCTTTATCAGTGGGTACAGG + Intronic
1157568297 18:48695349-48695371 GAGTCATTATAATGGGATCTGGG + Intronic
1158882475 18:61794212-61794234 GTGTCTATATCAGGGTAACCGGG - Intergenic
1159098039 18:63927561-63927583 GTGTCCTTATAAAGGGATTGAGG - Intronic
1164673866 19:30089100-30089122 GAGTGTTTATAAGAGGAGCCTGG + Intergenic
1166230477 19:41423363-41423385 TTGTCTTTGAAAGGGGATGCTGG + Intronic
1167458735 19:49612959-49612981 ATGTCTTTAAAAGGGGGGCCAGG - Intronic
927027160 2:19080294-19080316 GTGTCCTCATAAGGGTATACAGG + Intergenic
928700711 2:33895963-33895985 GTGTCCTTATAAGAGGATAATGG + Intergenic
930828963 2:55723160-55723182 GTGTCTATAGAAGAGCATCCAGG - Intergenic
932773155 2:74512990-74513012 GAGTCTTTCCCAGGGGATCCTGG + Intergenic
939771234 2:146322056-146322078 CTGTCTTCATAAGGGCAACCTGG - Intergenic
942082624 2:172415707-172415729 CTGTATTTCTAAGGAGATCCTGG - Intergenic
942505654 2:176638525-176638547 GTGGATTTAAAAGAGGATCCAGG - Intergenic
945365639 2:208949916-208949938 CTGTCTTTAAAAGGAGATTCAGG + Intergenic
948870613 2:240796048-240796070 GTGTCATTGTAAGGTGACCCAGG - Intronic
948884651 2:240876692-240876714 GTGGCTTTATGAGTGGACCCAGG - Intronic
1174699230 20:52590812-52590834 GTTTATTTAGAAGGTGATCCCGG + Intergenic
1177277769 21:18937048-18937070 GTTTCTTTAGAAGGGGAAGCTGG + Intergenic
1180433126 22:15273151-15273173 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1180515702 22:16141064-16141086 CTGTGTTAATAAGGGCATCCTGG - Intergenic
955832239 3:63016275-63016297 GTGTCTTTAAAAAGCAATCCGGG - Intergenic
957715489 3:83924995-83925017 GTGTTATTATTAGGGGATACTGG - Intergenic
961776005 3:129286049-129286071 AGGTCTTTGTAAGGAGATCCTGG - Intronic
963918861 3:150886774-150886796 GGGTCTTTATAAGGGAAAGCGGG - Intronic
965912719 3:173800288-173800310 GTTTCTTTGTAAGGGGACCTAGG - Intronic
966294896 3:178408193-178408215 GTGTCTTCAGAAGGGAATCTGGG - Intergenic
972581702 4:40400849-40400871 GTGTCCTTATAAGAGGAGACAGG + Intergenic
979946897 4:126843620-126843642 GTGTCTGGACAAGGGGAACCGGG - Intergenic
982497671 4:156110881-156110903 GTGTCTTTTTAAGGAGATTAAGG - Intergenic
983696679 4:170541145-170541167 GTGTCTTTATAAAGGAGGCCTGG + Intergenic
986962871 5:13236961-13236983 GGGTTTTTATAAGGGAATGCAGG - Intergenic
988345379 5:30030729-30030751 CTGTCTTTATAAGGTTTTCCAGG + Intergenic
988857583 5:35244399-35244421 GTGTCTTTATAAGGAGATGAAGG - Intergenic
990577598 5:57138206-57138228 GTGACTTTAAAAGGGGTTCTGGG - Intergenic
996794817 5:127333576-127333598 GTGTATTTATAAGTGGGTGCCGG - Intronic
996929212 5:128866235-128866257 AGGTCTTTATAAGGGGAAGCTGG + Intronic
997069185 5:130599381-130599403 GTGTCTTTATAAGAAGAGACAGG - Intergenic
998480445 5:142458655-142458677 GTGTCTTGATGAGGGGAACGTGG + Intergenic
1003389873 6:5704294-5704316 GTGTCTTTATAAAGGGGCCCTGG - Intronic
1003815480 6:9835672-9835694 GTGTATTTCTTTGGGGATCCAGG + Intronic
1003920541 6:10828579-10828601 GTGTCCTTATAAGAGGAGCCTGG + Intronic
1011265042 6:85508193-85508215 GTGTTTCTATAAGAGGCTCCTGG + Intronic
1013390982 6:109686228-109686250 GTGTCTTTATAAGGGGATCCGGG - Intronic
1015201364 6:130585078-130585100 GTGTCTATATAGGTGGATTCTGG + Intergenic
1016385734 6:143529286-143529308 GTGGCTTTAAGAGGGGCTCCTGG + Intergenic
1017148379 6:151255477-151255499 GTTTCTTTATTGTGGGATCCTGG + Intronic
1021861824 7:24913476-24913498 GTGACTTTATAAGGGAGTCAGGG - Intronic
1022201476 7:28121617-28121639 CTTTCATTATTAGGGGATCCAGG - Intronic
1025985730 7:66449742-66449764 GTGCCTTTATTTGTGGATCCTGG - Intergenic
1026029275 7:66775695-66775717 GTGCCTTTATTTGTGGATCCTGG + Intronic
1026286035 7:68963577-68963599 GGGATTTTATAAGGGGATCCTGG + Intergenic
1028291096 7:89065831-89065853 GAGTCTTTATAAAGGGAGGCAGG - Intronic
1028390492 7:90311198-90311220 GAGACTTCATAAGGGCATCCAGG - Intergenic
1031241822 7:119254409-119254431 TTGTCTTTATAAGGGCCACCGGG - Intergenic
1031907475 7:127476420-127476442 GTGTCTATATGAGGGGCCCCAGG + Intergenic
1035399132 7:158553393-158553415 GTGTGTGTATAAGGGGAGGCTGG - Intronic
1036620179 8:10419817-10419839 CTGTCTTTATAATGGCATCATGG + Intronic
1036702039 8:11019347-11019369 GTGTCTTTACCAGGGGATGGAGG - Intronic
1037553674 8:20001387-20001409 GGGTCTTTATTAGCTGATCCTGG + Intergenic
1041657779 8:60371032-60371054 GGGTCTTTATAAGTGGATGAAGG + Intergenic
1046204120 8:110967400-110967422 GTGTCATTATATGGGGATTCTGG - Intergenic
1055215121 9:73850473-73850495 GTTTATTTATAAGGGGATGATGG - Intergenic
1057495022 9:95553793-95553815 GTGTCTTTATAAGAGGCACGGGG + Intergenic
1185925647 X:4142772-4142794 GGGACTTTAAAAGGGGATCTTGG - Intergenic
1185926545 X:4153384-4153406 GAGTTTTTATAAGGAGATTCAGG - Intergenic
1195699711 X:107694716-107694738 GTGTCTTTATAAGGTAAAGCGGG + Intergenic