ID: 1013391909

View in Genome Browser
Species Human (GRCh38)
Location 6:109693774-109693796
Sequence AACCATTTGCTGAAACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013391909 Original CRISPR AACCATTTGCTGAAACAAAG AGG (reversed) Intronic
901137228 1:7005860-7005882 AGCCATTTGCAGAATCCAAGTGG + Intronic
901358127 1:8670352-8670374 AAACATTTGCTGAAATAATGGGG - Intronic
902096360 1:13949245-13949267 AAACATCTGCTGGCACAAAGTGG + Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905536715 1:38728300-38728322 ACCCATTTGCTGGAGCAATGAGG + Intergenic
908497850 1:64712960-64712982 AAAGATTTGCAGGAACAAAGTGG + Intergenic
909989754 1:82209250-82209272 AACAATTTGCTGCAAAAGAGGGG - Intergenic
910224539 1:84923016-84923038 AACCCATTGCTGACTCAAAGTGG - Intergenic
910464797 1:87486947-87486969 AACCATGCCCTGAAACCAAGAGG - Intergenic
910774332 1:90860241-90860263 AGCCATTTGGAGAAACACAGAGG + Intergenic
910934925 1:92479990-92480012 AACCATTTGGTGAAAAGAATAGG + Intronic
911009285 1:93262444-93262466 AAAAATTTGCCAAAACAAAGAGG + Intronic
911767769 1:101699954-101699976 CACTAATTGCTGAAACAAGGAGG - Intergenic
912042736 1:105412023-105412045 AGAAATTGGCTGAAACAAAGGGG - Intergenic
912116528 1:106414061-106414083 AAACATTTGGTGAAGAAAAGAGG - Intergenic
913440904 1:118896537-118896559 ACTCATATGCTGAAACAATGAGG + Intronic
916411423 1:164550784-164550806 AAACATTGGCCAAAACAAAGGGG + Intergenic
917437157 1:175033096-175033118 AAGCATTTGATGAACTAAAGGGG - Intergenic
917528227 1:175808634-175808656 AACCTTTTGCTGTAATAAACTGG - Intergenic
918100625 1:181370201-181370223 GATGATTTTCTGAAACAAAGAGG - Intergenic
918409070 1:184239872-184239894 ATACATTTGTTGAACCAAAGGGG - Intergenic
918633591 1:186748228-186748250 AGAAATTGGCTGAAACAAAGGGG - Intergenic
919787389 1:201268486-201268508 AATCATTGGCTGGAACGAAGAGG + Intergenic
920070527 1:203299596-203299618 AAGAATTTCCTGATACAAAGTGG - Intergenic
920918336 1:210276746-210276768 AACCATATGAAGATACAAAGAGG - Intergenic
922549558 1:226484119-226484141 AACAATTTGCAGAACCAAGGTGG - Intergenic
923508691 1:234630081-234630103 AACCATTTTCTAAGACAATGGGG + Intergenic
924013682 1:239695924-239695946 ATCCATTCACTAAAACAAAGGGG - Intronic
1066358116 10:34704394-34704416 AACCATATTTTGTAACAAAGTGG + Intronic
1067214298 10:44288118-44288140 CATTATTTGCTGAAACAAAAAGG - Intergenic
1071097242 10:81991268-81991290 AACCATTTTCTGAACAAAAAAGG - Intronic
1071123652 10:82309693-82309715 AAAAATTGACTGAAACAAAGAGG + Intronic
1072553449 10:96496355-96496377 AACCCTTAGCTGGAACAAATGGG - Intronic
1074992074 10:118718038-118718060 AGCCATTTGCTGAAAGGAAGGGG + Intronic
1075062781 10:119268393-119268415 GACCATCTGCTGAAACCAACGGG - Intronic
1075085702 10:119413056-119413078 TCCCAGTTGCTCAAACAAAGAGG + Intronic
1076545102 10:131239994-131240016 ACCCATTTCCTGAAACCACGGGG - Intronic
1080073431 11:28117504-28117526 AACTATTTTCTAAAACCAAGTGG + Intronic
1081360801 11:42175372-42175394 AAATATTTGCTGAATCATAGTGG + Intergenic
1081400448 11:42636493-42636515 AAAAATTGGCTAAAACAAAGGGG - Intergenic
1083795909 11:65016582-65016604 AACCATTTGCTGAGATGGAGAGG + Intronic
1084577589 11:69999719-69999741 AAACATTTGCTGAATGAATGAGG + Intergenic
1084721816 11:70911001-70911023 CAGCATTTGCAGAAACGAAGGGG + Intronic
1086385153 11:86299571-86299593 AACCATATACTGAAAAAAAGTGG - Intergenic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1090433496 11:126666401-126666423 AACCATTTCCTGAAAAATAGAGG + Intronic
1092112064 12:5970940-5970962 AGCCATTTTCTTAAACACAGAGG - Intronic
1092335024 12:7624778-7624800 AAGCAGATGCTAAAACAAAGTGG + Intergenic
1093003013 12:14020328-14020350 AAACATTTTCAGAAAAAAAGAGG - Intergenic
1093263950 12:16977648-16977670 CACCATTAGCTGAAAAAAACTGG + Intergenic
1093283989 12:17234672-17234694 AACCATTTGATGATCCAAAAAGG + Intergenic
1093493337 12:19728515-19728537 AAACATTTGCTGAATAAAATAGG + Intergenic
1095168493 12:39004564-39004586 AAACATCTGTTGAAATAAAGGGG - Intergenic
1098701118 12:73628101-73628123 AAAAATATGCTGGAACAAAGTGG - Intergenic
1099848869 12:88065630-88065652 TATCATTTGCTGAATCAAATAGG - Intronic
1101061613 12:100978334-100978356 AAACATTTGCTCAAACAGTGGGG + Intronic
1101307392 12:103542793-103542815 ATCCATTGGTTGAATCAAAGAGG - Intergenic
1102568604 12:113813667-113813689 AACCATCTCCTGAAGCACAGAGG + Intergenic
1104036959 12:125104334-125104356 TACCACTTGCTGGAACAAAAAGG - Intronic
1105309787 13:19196069-19196091 AAAAATGTGCTGAAACAAATGGG - Intergenic
1105693227 13:22862663-22862685 CACCATTTGTTAAAAAAAAGTGG - Intergenic
1108487519 13:50941925-50941947 AACCATAGGCTGAAACAGAGAGG + Intronic
1108676927 13:52745190-52745212 GACCATCTGCTGAGACAAAGAGG + Intergenic
1109936334 13:69289701-69289723 ACCCCTTTGCTGTAACAAAATGG + Intergenic
1110254562 13:73418286-73418308 AACAATTGGCTGAAGCTAAGGGG - Intergenic
1111770080 13:92585407-92585429 AGGCATTGGCTGAAACAAAGGGG - Intronic
1115372300 14:32630718-32630740 AACCCTTTCCTGATACAAAGGGG + Intronic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1120622006 14:86775787-86775809 AAACATTGGCCAAAACAAAGGGG - Intergenic
1120649520 14:87114888-87114910 CATCATTTGCTCAAACCAAGGGG - Intergenic
1121522648 14:94597106-94597128 AAACATTTTCTTAAAAAAAGGGG - Intronic
1121932530 14:97985638-97985660 CACCAGTTGCTGAAAGACAGAGG - Intergenic
1122136933 14:99638736-99638758 AATCATTTGCTGAAGAAAACTGG + Intergenic
1122746828 14:103902402-103902424 AACTATTTGCTCAAATAAAGGGG + Intergenic
1123704914 15:22944421-22944443 AACCAGTTTCTGAGACAAAAGGG - Intronic
1124340816 15:28888139-28888161 AACATTTTGTTGAAAAAAAGAGG - Intronic
1126176879 15:45744137-45744159 AAACAATTGCAGAATCAAAGAGG + Intergenic
1126185006 15:45823300-45823322 AGAAATTGGCTGAAACAAAGGGG + Intergenic
1127948346 15:63778457-63778479 AAGCATTTGTTGAAACGCAGAGG + Intronic
1128738682 15:70068447-70068469 AACAATTTGTCTAAACAAAGGGG - Intronic
1129139119 15:73581123-73581145 CCCCATTTGCTGATACAAACAGG + Intronic
1129171188 15:73809099-73809121 GAAAATTTGCTGAAACAAAATGG - Intergenic
1129976181 15:79823761-79823783 ATCCATCTGCTGTAACAAACTGG + Intergenic
1130361909 15:83196878-83196900 AACAATTTGCTGAAAATGAGGGG + Intronic
1133645058 16:7756271-7756293 AATCAATTGCTGGAACAAATGGG - Intergenic
1134149110 16:11791740-11791762 AACCCTTTGGGGAAACAAGGTGG + Intronic
1134769328 16:16793086-16793108 AACCTATTGCAGAAATAAAGGGG + Intergenic
1135530017 16:23245287-23245309 AACCATTTTCAGAAAGAATGTGG + Intergenic
1136271186 16:29149145-29149167 AACCATTTCCTGCAGCAATGGGG + Intergenic
1136528996 16:30854148-30854170 ATCCATTGGTTGAAACAAAGAGG + Intronic
1137390304 16:48075753-48075775 TACCAATTGCAGAAGCAAAGAGG + Intergenic
1138529589 16:57627937-57627959 ATCCATCTGCTGAGCCAAAGGGG - Intronic
1141609667 16:85174282-85174304 AACAATTTCTTGAAAGAAAGTGG + Intronic
1144220624 17:13096762-13096784 AAACAATTCCTGAAACACAGTGG - Intergenic
1148377477 17:47161383-47161405 AAACATTTGCTGAAAGTAATAGG + Intronic
1149163854 17:53726533-53726555 AGACATTGGCCGAAACAAAGGGG + Intergenic
1151615986 17:75211888-75211910 AGAAATTTGCTGAAAGAAAGAGG - Intronic
1151861226 17:76763680-76763702 GAGCGTTTGCTGAAACAAAATGG - Intronic
1152921713 17:83069163-83069185 AACCATTTCCTGAAAAATTGGGG - Intergenic
1155790441 18:29961512-29961534 AACCATTTGCTGAACAATAAAGG - Intergenic
1155832137 18:30530825-30530847 AAATATTTCCAGAAACAAAGAGG + Intergenic
1155938023 18:31774580-31774602 AACCATTTTCTTAACCACAGTGG + Intergenic
1156666360 18:39412525-39412547 ATGAATTTGTTGAAACAAAGAGG - Intergenic
1156772909 18:40750953-40750975 AACCATTTCCCGAAACAAGTAGG + Intergenic
1157633385 18:49124093-49124115 AGTAATTTGCTGAAACAAACAGG + Intronic
1158916762 18:62139913-62139935 GGTGATTTGCTGAAACAAAGTGG - Intronic
1159919841 18:74217559-74217581 CACCGTTTGCTGAAACAGAAGGG - Intergenic
1162250003 19:9434620-9434642 AACCATATATTGGAACAAAGTGG + Intronic
1167720437 19:51176184-51176206 AAACATTTGATGAAAAAAAATGG + Intergenic
925699221 2:6616581-6616603 AACCCTGTGATGAAACAAGGAGG + Intergenic
927335633 2:21920560-21920582 AAATATTTGCTGAATCAAATTGG + Intergenic
927604377 2:24473031-24473053 AATCATCTGCTGACCCAAAGGGG + Intergenic
927790508 2:26005907-26005929 GAACCTTTGCTGAAACAATGGGG - Intergenic
928812604 2:35247671-35247693 AACAATTGGCCAAAACAAAGGGG + Intergenic
929275641 2:40021840-40021862 AGACATTAGCCGAAACAAAGGGG - Intergenic
931591760 2:63891829-63891851 CTCCATTTATTGAAACAAAGTGG + Intergenic
932475146 2:72000904-72000926 AATCCTTTTGTGAAACAAAGAGG - Intergenic
932505457 2:72226099-72226121 AACCATTTGCTGGAAAAAGAGGG + Intronic
933493704 2:83020726-83020748 AACAATTTGGTGAAAGAAAAGGG + Intergenic
933570433 2:84004483-84004505 GAGCATTTGCCCAAACAAAGAGG + Intergenic
933824466 2:86146272-86146294 AACTACTTGCTGAAGCAAAGAGG + Intronic
936821861 2:116530956-116530978 AACAATTGGCCAAAACAAAGGGG - Intergenic
937680403 2:124637960-124637982 TACCATTTGCTACAAAAAAGAGG - Intronic
939826681 2:147023922-147023944 AGAAATTGGCTGAAACAAAGGGG + Intergenic
940506009 2:154554137-154554159 AGCCATTTGCTCCAACAATGGGG + Intergenic
940712230 2:157176354-157176376 AGGAATTGGCTGAAACAAAGGGG - Intergenic
942367008 2:175238763-175238785 AGCCATTGGCCAAAACAAAGGGG + Intergenic
942577935 2:177384829-177384851 AACCATTATTAGAAACAAAGAGG + Intronic
943132481 2:183871337-183871359 AGCCATTTACTAAAGCAAAGAGG + Intergenic
943427291 2:187752374-187752396 AGAAATTGGCTGAAACAAAGGGG + Intergenic
943622669 2:190167647-190167669 AGAAATTGGCTGAAACAAAGGGG + Intronic
943676921 2:190724723-190724745 AACTGTTTGTTAAAACAAAGTGG + Intergenic
943693336 2:190893084-190893106 AACCATTTGCTGTAAATAATTGG + Intronic
944155707 2:196605323-196605345 AACCATTGTCTGAAACAATATGG + Intergenic
946089542 2:217208413-217208435 AACTATTTGTTAAAACAAATTGG - Intergenic
946159706 2:217828580-217828602 AACCAGCAGGTGAAACAAAGTGG - Intronic
947882718 2:233533437-233533459 AGCCATTAACTGAAACAAATAGG + Intronic
1169692552 20:8348216-8348238 AAGCATTTGCTGAAAGACAGTGG - Intronic
1169965105 20:11208614-11208636 AACCATGTGAGGAAACAAAAGGG - Intergenic
1170538729 20:17367216-17367238 CACAATATGCTGAAACCAAGTGG + Intronic
1170783345 20:19446894-19446916 ATCCATTTAATGACACAAAGTGG - Intronic
1172604001 20:36202439-36202461 AACCATTTCCTGGGAGAAAGTGG - Intronic
1175207733 20:57324549-57324571 AAACAATTGCTGAAACAATTGGG + Intergenic
1177014860 21:15773837-15773859 ACACATTTGCTGAAACAAAATGG + Intronic
1177447975 21:21222874-21222896 AATTATTTTGTGAAACAAAGAGG + Intronic
1177622777 21:23618279-23618301 AAGAATTTGCTGACAAAAAGAGG + Intergenic
1182672825 22:32011534-32011556 AACCAATGGCTCAAAAAAAGGGG - Intergenic
949405805 3:3713287-3713309 TACCATTTGGGGAAACCAAGAGG - Intronic
950792039 3:15479715-15479737 TCCCATTTGCTGAAAACAAGAGG + Intronic
951060855 3:18205522-18205544 AACCATTTCCTCATATAAAGCGG + Intronic
954647919 3:52142849-52142871 AACCTTTAGCTGAAACTAGGGGG - Intronic
955826383 3:62951902-62951924 AAACATTGGCCAAAACAAAGGGG - Intergenic
955877665 3:63510285-63510307 AACCATCTGTTGAAACTAAAGGG - Intronic
956291469 3:67664600-67664622 AACCATGGGCTGAAATAATGTGG + Intergenic
956475033 3:69610521-69610543 AACAATTGGCCAAAACAAAGGGG - Intergenic
958674234 3:97246172-97246194 AATCATCTGCTGAAGCAGAGAGG - Intronic
958823391 3:99002233-99002255 AGAGATTGGCTGAAACAAAGGGG + Intergenic
959022426 3:101202818-101202840 TGCCATTTGCTGAGAAAAAGAGG - Intergenic
959758927 3:109934294-109934316 AACCAATTCCTGTAACATAGAGG + Intergenic
960564330 3:119117838-119117860 AAAAATTGGCTAAAACAAAGGGG + Intronic
963270673 3:143283074-143283096 AAGCATTTGTGGAAACAAAGAGG - Intronic
963326456 3:143868758-143868780 AAACACTTGCTTAAACAAACAGG + Intergenic
963396749 3:144744278-144744300 AACCATTTGCTTTAATGAAGTGG + Intergenic
963816213 3:149834090-149834112 AAGACTTTGCTGAAATAAAGAGG + Intronic
964698213 3:159533992-159534014 AACCATTTGCAATAACAAGGAGG - Intronic
965065339 3:163840805-163840827 AGAAATTGGCTGAAACAAAGGGG + Intergenic
967689614 3:192458543-192458565 AAAAATTGGCTAAAACAAAGGGG - Intronic
967804823 3:193706228-193706250 AGCCATTTTCTCAAACTAAGCGG + Intergenic
967898244 3:194418116-194418138 AAGCAATTGCTGAAACAAATGGG + Intronic
968035026 3:195541188-195541210 AACCAATTACAGAAAGAAAGAGG + Intronic
968342688 3:197970659-197970681 AACTATTTGCAGAAACAATATGG - Intronic
971131643 4:23817616-23817638 CACCATTTGTTGAAACAAATAGG + Intronic
971650563 4:29267035-29267057 CATCATTTGCTCAAACCAAGGGG - Intergenic
974523001 4:63009746-63009768 CATCATTTGCTCAAACCAAGGGG - Intergenic
974696442 4:65380880-65380902 AACCATTTTGTGAAACAATAGGG - Intronic
974822210 4:67081653-67081675 AACCATTTACTTAAAGACAGAGG - Intergenic
976539799 4:86261294-86261316 AATCATTTGCTGGTGCAAAGTGG + Intronic
978010744 4:103680140-103680162 ACCCATTTGATGAAACATATGGG + Intronic
979218157 4:118191188-118191210 TACCATTTGCTCAAACCAAGGGG + Intronic
981006136 4:139877244-139877266 AACCATTTGTTGTCATAAAGAGG + Intronic
981442277 4:144796912-144796934 AAAAATTGGCTGAAAGAAAGGGG - Intergenic
982114070 4:152082595-152082617 AATCATTTGCGTAAACAGAGTGG + Intergenic
982121579 4:152148376-152148398 AATCATTTGATTAAACAATGTGG - Intergenic
982868123 4:160543615-160543637 AAAAATTTGCCAAAACAAAGGGG + Intergenic
983454411 4:167944769-167944791 GACCATTTTCTCAAAGAAAGGGG - Intergenic
984017294 4:174441531-174441553 AGAAATTGGCTGAAACAAAGGGG + Intergenic
985365067 4:189221719-189221741 AACCATTTGTAAGAACAAAGCGG + Intergenic
986097126 5:4569932-4569954 AACCAATAGCTGAGCCAAAGAGG - Intergenic
986118530 5:4805458-4805480 TACCATTTGCTTAAAAAAAAAGG - Intergenic
986238355 5:5933698-5933720 TCCCATTTGCTGAACCTAAGTGG - Intergenic
986869161 5:12027503-12027525 AGAAATTGGCTGAAACAAAGGGG + Intergenic
987562303 5:19540138-19540160 AAAAATTGGCCGAAACAAAGGGG + Intronic
988130515 5:27097774-27097796 ACCCAGTTGCTCAAACCAAGGGG + Intronic
990032439 5:51278098-51278120 AACCATTTCTTGAAAAAAAATGG - Intergenic
990492620 5:56317547-56317569 AAGCCTTTTGTGAAACAAAGTGG + Intergenic
992036569 5:72784326-72784348 AAGCATTTTCTGTAACTAAGAGG + Intergenic
992941717 5:81769113-81769135 AATCAGTTTCTGAACCAAAGAGG + Intergenic
993235496 5:85303125-85303147 AAGCATTTACTGAAGCAAGGTGG - Intergenic
995046976 5:107661609-107661631 AACAATTAGGTTAAACAAAGTGG - Intronic
995981943 5:118114622-118114644 AAGCATTAGCTGAAAGAAGGAGG - Intergenic
997830082 5:137142140-137142162 AAACATTTGGTTAAACAAATTGG + Intronic
997977350 5:138448233-138448255 AACCAAGGGCTGAGACAAAGAGG + Intergenic
998126838 5:139629843-139629865 AATAACTTGTTGAAACAAAGAGG - Intergenic
999077645 5:148812206-148812228 ATCCATTAGTTGGAACAAAGGGG + Intergenic
1001750919 5:174130726-174130748 AACCATGTTCTAAAACAAACAGG + Intronic
1003838118 6:10093060-10093082 AGAAATTGGCTGAAACAAAGCGG + Intronic
1004757144 6:18622996-18623018 AACTCTTTGCTGAAAAAAAAAGG - Intergenic
1005350715 6:24932551-24932573 AAACAATTGCTGAAGCAAACAGG + Intronic
1005419662 6:25635841-25635863 AATCATTTGTTGAAAAAAACAGG - Intergenic
1007328457 6:41082750-41082772 AAGCATTTGGTGTAGCAAAGGGG + Intronic
1009639116 6:66307557-66307579 AACAGTCTTCTGAAACAAAGGGG - Intergenic
1011664837 6:89623751-89623773 CACCATGAGGTGAAACAAAGTGG + Intronic
1012068151 6:94576866-94576888 AGAAAGTTGCTGAAACAAAGGGG + Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1013462397 6:110387633-110387655 AAATATTTGCTTAAACAAGGTGG - Intergenic
1014047643 6:116911381-116911403 GACCATTTGCTGAAATAAAATGG - Intronic
1015277240 6:131396445-131396467 CACCATTTGTTGAAAAAAACTGG - Intergenic
1015944206 6:138483438-138483460 AAGCTTTTCCTGAAACAAAATGG - Intronic
1016463453 6:144302571-144302593 AACCATTTGCTGAATGAATGAGG - Intronic
1016556099 6:145340625-145340647 AATCCTTTGCTGGAACATAGAGG + Intergenic
1019193929 6:170270321-170270343 AACTGTTGGCTGAGACAAAGGGG + Intergenic
1020579106 7:9971800-9971822 AAAAATTGGCTGAAACAAAGGGG - Intergenic
1020896129 7:13942321-13942343 AACCACTTGTTTAAAAAAAGAGG - Intronic
1023435017 7:40133914-40133936 AACTATTTCTTGAAACAAACTGG + Intronic
1023822231 7:43986626-43986648 GACCCGTGGCTGAAACAAAGTGG - Intergenic
1024195950 7:47059159-47059181 AGCCATTTTCTGGAACAAAAAGG - Intergenic
1024667343 7:51559871-51559893 AGAAATTGGCTGAAACAAAGGGG - Intergenic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1027845669 7:83370831-83370853 ATCCATTTGTTGAAATAAGGGGG - Intronic
1027969682 7:85062796-85062818 AACCTTTTCCTGTAACTAAGTGG - Intronic
1028075576 7:86510136-86510158 AATCATTTTCTTAAGCAAAGAGG + Intergenic
1029750497 7:102540040-102540062 GACCCGTGGCTGAAACAAAGTGG - Intronic
1030010122 7:105157441-105157463 AAACATAGGCTGAATCAAAGGGG + Intronic
1030908646 7:115218621-115218643 AACCTTTGGCTGATTCAAAGTGG + Intergenic
1031218004 7:118922453-118922475 CATCATTTGCTCAAACCAAGGGG - Intergenic
1032331438 7:130984582-130984604 AAGCATTTGTTAAAAAAAAGAGG + Intergenic
1032586888 7:133155037-133155059 AAGCATTTGCTGATAGAATGTGG + Intergenic
1034571931 7:151963189-151963211 AAACATTTGCAGAACTAAAGGGG - Intronic
1035098015 7:156372072-156372094 AAGCATTATCTGAAACAAAGAGG - Intergenic
1038883260 8:31638015-31638037 AGCGATTTACTGAAAGAAAGTGG - Intergenic
1039349020 8:36740843-36740865 AACCAATGGCTTAAACAAAAGGG + Intergenic
1039362853 8:36898819-36898841 AACCTTATGCTGAAAAAAATTGG + Intronic
1041202113 8:55460386-55460408 AACCATATGCTTAAAACAAGTGG + Intronic
1041312766 8:56533390-56533412 AATCATTTGCTAAGCCAAAGAGG + Intergenic
1041495982 8:58485815-58485837 TACTATTTGCTGAAACAAACTGG - Intergenic
1042081010 8:65050801-65050823 CACCTTTTGCTGAAACAAGGCGG + Intergenic
1042949055 8:74182228-74182250 AAGGATTTGCTGAATCAAAAGGG - Intergenic
1043947336 8:86269241-86269263 AACTATTTGATGAAAGAATGAGG + Intronic
1044034303 8:87280001-87280023 ACCTATATGCTGAATCAAAGAGG - Intronic
1044118803 8:88367931-88367953 AAGCATTTTCTGAAACATGGAGG - Intergenic
1045561906 8:103271921-103271943 AAAAATTGGCTAAAACAAAGGGG - Intergenic
1045814778 8:106267212-106267234 AACCATTTGATAATAAAAAGTGG - Intergenic
1046411730 8:113853211-113853233 AACTATTTGATGAAAAAAATGGG + Intergenic
1046596134 8:116263525-116263547 AACCATTTGCAGAAACCAGTGGG + Intergenic
1046607692 8:116389336-116389358 AGAAATTGGCTGAAACAAAGGGG - Intergenic
1047053516 8:121139126-121139148 AGGAATTGGCTGAAACAAAGGGG - Intergenic
1047116040 8:121842776-121842798 AGAAATTTACTGAAACAAAGGGG - Intergenic
1048501372 8:134978504-134978526 AACTATTTTCTGAACCAAAATGG - Intergenic
1048643644 8:136392798-136392820 CACCATTGTTTGAAACAAAGTGG + Intergenic
1048676714 8:136792152-136792174 TACCATTTGCTGAAAGAAGTTGG + Intergenic
1050079878 9:1904798-1904820 ATAAATTGGCTGAAACAAAGGGG - Intergenic
1050560602 9:6831216-6831238 AATCAGTGGCTGAAACAAATTGG + Intronic
1050695484 9:8275367-8275389 AGAAATTGGCTGAAACAAAGGGG + Intergenic
1050844645 9:10199534-10199556 ACCCATTTCTTGAAACACAGGGG - Intronic
1052210109 9:25893737-25893759 AGAAATTGGCTGAAACAAAGGGG + Intergenic
1052382810 9:27789671-27789693 CTCCATTGACTGAAACAAAGGGG - Intergenic
1052885254 9:33640358-33640380 AAGCATTTGCGGAATCAAAATGG - Intergenic
1055475425 9:76658510-76658532 AAACATTTGCAGAAATGAAGTGG + Intronic
1056257543 9:84815469-84815491 AACCATTTGCTGTAATCCAGAGG + Intronic
1056945543 9:90992576-90992598 AACCATTTGCTACAACAATTGGG + Intergenic
1057564864 9:96158748-96158770 TGCGATTTGCTAAAACAAAGGGG - Intergenic
1058082152 9:100712001-100712023 AGAAATTGGCTGAAACAAAGGGG + Intergenic
1058410004 9:104721268-104721290 AACAATTTTCTGATCCAAAGGGG - Intergenic
1059832661 9:118115752-118115774 AACAATTTTATGCAACAAAGTGG + Intergenic
1059871936 9:118587330-118587352 AAAAACTGGCTGAAACAAAGGGG - Intergenic
1060653490 9:125351589-125351611 AAAAATTGGCAGAAACAAAGGGG + Intronic
1062219319 9:135405898-135405920 AACGATTTCCTGACCCAAAGAGG - Intergenic
1203452771 Un_GL000219v1:135994-136016 AAGCATTTGGGGAAACAGAGGGG - Intergenic
1187166135 X:16805566-16805588 AACCATATGGGGGAACAAAGGGG - Intronic
1187728085 X:22224343-22224365 AAACATTTCCTGAAACCAATAGG - Intronic
1189234670 X:39477935-39477957 AAACATTTGCTGACAGGAAGAGG - Intergenic
1189726047 X:43969242-43969264 ACCCATTTAGTGAAAGAAAGAGG - Intronic
1190057251 X:47188147-47188169 AACCCTTTCTTGAAAAAAAGAGG + Intergenic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG + Intergenic
1193814967 X:86093924-86093946 AATCAGTTGCTGAAAATAAGAGG + Intergenic
1194216082 X:91131919-91131941 AACCATTTGCTTACACATATAGG + Intergenic
1194834984 X:98671113-98671135 CACTATTTGCATAAACAAAGAGG + Intergenic
1194885429 X:99309933-99309955 AACCATTAGAAGAATCAAAGGGG + Intergenic
1194899260 X:99487918-99487940 AAATATTTGCTGGAATAAAGAGG - Intergenic
1195314465 X:103664613-103664635 CACCATTTTCTGAATCAAAATGG - Intergenic
1196654034 X:118198296-118198318 AGACATTTCCTTAAACAAAGAGG + Intergenic
1199529249 X:148828622-148828644 AACCTTTTGCTGAACTAAAAAGG + Intronic
1199849123 X:151712674-151712696 AAGCTTTTGCTGAAACCTAGAGG - Intergenic
1201625582 Y:16011515-16011537 AACAATTTTGTGTAACAAAGTGG + Intergenic
1202096527 Y:21255208-21255230 AAACATTTTCTCAAACAAAAAGG - Intergenic