ID: 1013393627

View in Genome Browser
Species Human (GRCh38)
Location 6:109712779-109712801
Sequence CAGTTGTTTTGGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013393624_1013393627 -5 Left 1013393624 6:109712761-109712783 CCTTGCTGGAGAAAAGTGCAGTT 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG No data
1013393622_1013393627 8 Left 1013393622 6:109712748-109712770 CCAGGTTCAGAACCCTTGCTGGA 0: 11
1: 58
2: 139
3: 312
4: 659
Right 1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG No data
1013393620_1013393627 17 Left 1013393620 6:109712739-109712761 CCATCTCAGCCAGGTTCAGAACC 0: 1
1: 16
2: 61
3: 174
4: 439
Right 1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG No data
1013393623_1013393627 -4 Left 1013393623 6:109712760-109712782 CCCTTGCTGGAGAAAAGTGCAGT 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013393627 Original CRISPR CAGTTGTTTTGGAGGAAAAA AGG Intronic
No off target data available for this crispr