ID: 1013395862

View in Genome Browser
Species Human (GRCh38)
Location 6:109738924-109738946
Sequence TCCCACTATATCCTACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013395862_1013395866 -5 Left 1013395862 6:109738924-109738946 CCAGGAGGTAGGATATAGTGGGA 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1013395866 6:109738942-109738964 TGGGAAGGAGATTGGTATGTGGG 0: 1
1: 0
2: 1
3: 37
4: 294
1013395862_1013395867 5 Left 1013395862 6:109738924-109738946 CCAGGAGGTAGGATATAGTGGGA 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1013395867 6:109738952-109738974 ATTGGTATGTGGGAGTCAGATGG 0: 1
1: 0
2: 0
3: 17
4: 206
1013395862_1013395865 -6 Left 1013395862 6:109738924-109738946 CCAGGAGGTAGGATATAGTGGGA 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1013395865 6:109738941-109738963 GTGGGAAGGAGATTGGTATGTGG 0: 1
1: 0
2: 2
3: 26
4: 328
1013395862_1013395868 26 Left 1013395862 6:109738924-109738946 CCAGGAGGTAGGATATAGTGGGA 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1013395868 6:109738973-109738995 GGCCAGTCACCAGATTGCCTTGG No data
1013395862_1013395870 29 Left 1013395862 6:109738924-109738946 CCAGGAGGTAGGATATAGTGGGA 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1013395870 6:109738976-109738998 CAGTCACCAGATTGCCTTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013395862 Original CRISPR TCCCACTATATCCTACCTCC TGG (reversed) Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903162593 1:21499942-21499964 TCCTGCTCTCTCCTACCTCCTGG - Intergenic
905056132 1:35095416-35095438 TCTCACTATAACCTACTTCTGGG - Intronic
907543952 1:55242938-55242960 CCCCACAAAATCCTAACTCCTGG - Intergenic
907737212 1:57125984-57126006 TCCTTGTATCTCCTACCTCCTGG - Intronic
912267293 1:108171508-108171530 TCCCCATATATGCTGCCTCCAGG + Intronic
912604019 1:110969413-110969435 TCCCAATTATTCCTACCTCCTGG - Intergenic
912995482 1:114528848-114528870 TCCCACAAAATCCTAGCTCTCGG - Intergenic
916235865 1:162587537-162587559 TCTCACTATATTCTACCACCTGG - Exonic
917160383 1:172050898-172050920 TCCCATTTTATCCAACCTACTGG + Intronic
919116185 1:193283410-193283432 TCCCAATAAATCCCACCTCCTGG - Intergenic
1067697798 10:48548237-48548259 TCCCATCACATCCTACCCCCTGG + Intronic
1069791294 10:71023744-71023766 TCCCACTATAGGCCACCTTCAGG + Intergenic
1071857778 10:89644231-89644253 GCCCACTTTATCCTCACTCCTGG + Intronic
1073974470 10:109085546-109085568 TCCCACTATGTCCTCCCCTCGGG + Intergenic
1075080354 10:119379378-119379400 TACCACGAGATCCTCCCTCCCGG + Intronic
1079835285 11:25326515-25326537 GCTCACTAAATCCTTCCTCCTGG - Intergenic
1085936939 11:81157796-81157818 CCCCACCAAATCCTCCCTCCAGG + Intergenic
1088118714 11:106342154-106342176 TCCCTCTAGATCCTATCTCTTGG - Intergenic
1090723728 11:129502030-129502052 TCCAACTATATGCTGCCTACAGG + Intergenic
1091697451 12:2637626-2637648 TCCCACTAGATTCTGCCTCCAGG + Intronic
1097591932 12:61585256-61585278 TCTCCCTACATCCTACCTCCTGG - Intergenic
1101933426 12:109035029-109035051 TCCAACTATATTCTATCTTCAGG - Intronic
1103227065 12:119296909-119296931 TCCCACTATAGATTACCTCTGGG + Intergenic
1105574669 13:21639148-21639170 TGCCACTGTATCATACCACCAGG - Intergenic
1106593931 13:31121193-31121215 GCCCACTCTTTCCTACCTCCTGG - Intergenic
1107725799 13:43298112-43298134 TTCCTTTATTTCCTACCTCCAGG + Intronic
1108372193 13:49781055-49781077 TCACACTATCTCTTACTTCCAGG + Intronic
1115360123 14:32491153-32491175 TCCCACCAGATGCTTCCTCCTGG + Intronic
1120713317 14:87815529-87815551 TCCCACTCTTTCCTCCCTTCCGG + Intergenic
1127956998 15:63862559-63862581 TCCCTCTATGTCCTACCCCCAGG + Intergenic
1129723266 15:77889251-77889273 CCCCACTTTGTCTTACCTCCAGG - Intergenic
1130416716 15:83701332-83701354 TCACACTATCACCCACCTCCTGG - Intronic
1130515738 15:84624579-84624601 TCCCGCTGTTTCCCACCTCCAGG + Intronic
1131958448 15:97763306-97763328 TCCCACTATAATCTACACCCAGG + Intergenic
1135514671 16:23120816-23120838 TCCCACCTTATTCTGCCTCCTGG - Intronic
1136063983 16:27746608-27746630 TGCCACTTTATCCTCGCTCCTGG - Intronic
1137625218 16:49903471-49903493 TCCCCCAGTATCCCACCTCCAGG + Intergenic
1138524673 16:57596054-57596076 TCCCAGTGAACCCTACCTCCTGG - Intergenic
1138739980 16:59296909-59296931 TCTCACTATAGCCTCACTCCTGG + Intergenic
1139914099 16:70417677-70417699 TCCCCCTCTCTCCTACCTTCAGG - Intronic
1143923825 17:10351984-10352006 TCCCCATATATCCCAGCTCCTGG - Intronic
1145371423 17:22309604-22309626 TCCCACTTCAGCCTACCTACTGG - Intergenic
1146799297 17:35805779-35805801 TCCCTCTACATCCTCCCTCCTGG - Intronic
1147925277 17:43941964-43941986 TCCCACTAGCTGCTGCCTCCTGG - Intronic
1148401749 17:47368484-47368506 TATCACTATATTCTACCACCTGG - Intronic
1149570499 17:57668967-57668989 TACCAGTCTCTCCTACCTCCAGG + Intronic
1150207146 17:63417685-63417707 TCACACTTGATCCTACCCCCGGG + Intronic
1152606775 17:81295342-81295364 TCCCACCAAACCCTACCCCCTGG - Intronic
1155127857 18:22897915-22897937 TCTCACTCTACCCTACCCCCTGG + Intronic
1155812682 18:30258277-30258299 TCCCCCTCTCTCCTAACTCCTGG + Intergenic
1157855399 18:51100463-51100485 TCCCACTCCATCCTCCCTTCTGG + Intergenic
1161618758 19:5287272-5287294 TCCCCCTACATTCTACATCCCGG + Intronic
1161835737 19:6645119-6645141 TCCCAAAAATTCCTACCTCCTGG - Intergenic
1162177017 19:8838293-8838315 CCCCACTATCACCTTCCTCCAGG + Intronic
1166669133 19:44699390-44699412 TTCCACTGTTTCCTACCTCCAGG - Intronic
1168113605 19:54208738-54208760 TCCCACTCTCCCCTCCCTCCAGG - Intronic
1168501888 19:56899799-56899821 GCCCACAAGATCCTGCCTCCCGG - Intergenic
925057941 2:869701-869723 TCCCACCAGGTCCCACCTCCAGG - Intergenic
927380899 2:22477756-22477778 TACCACTATAACTTGCCTCCAGG - Intergenic
928466927 2:31531113-31531135 TCCCACTCTCTCCCACCTTCCGG + Intronic
930726307 2:54685345-54685367 TCTGACTATATCCTGCCACCAGG + Intergenic
933273761 2:80262110-80262132 TCACACAAGATCCTACCACCTGG + Intronic
933998779 2:87689159-87689181 TCCCACTAGGGCCCACCTCCAGG + Intergenic
936012921 2:108936520-108936542 TCCCACGCTCTCCTTCCTCCAGG + Intronic
936295071 2:111261719-111261741 TCCCACTAGGGCCCACCTCCAGG - Intergenic
937200049 2:120196473-120196495 TCTCATTATTTCCTCCCTCCTGG - Intergenic
947373874 2:229475569-229475591 TAGCATTATATCCTAGCTCCTGG + Intronic
1170697010 20:18668274-18668296 TCCAACTATATCCTACAACCAGG - Intronic
1171216419 20:23355924-23355946 TCCCACTCTATCCTGCTGCCTGG + Intergenic
1171326929 20:24302818-24302840 TCCTACTTTATCCTACCGCCTGG - Intergenic
1175401625 20:58703065-58703087 GCCCATGATTTCCTACCTCCCGG - Intronic
1175453826 20:59094746-59094768 TCCCAGCATTTCCCACCTCCAGG + Intergenic
1176937987 21:14888859-14888881 TCTCACTCTTTCCTATCTCCTGG + Intergenic
1179579492 21:42331932-42331954 TCCCACAATTTCCCACCTCTAGG - Intergenic
1180747695 22:18102443-18102465 TGGCACTAGATCCCACCTCCAGG - Exonic
1184232378 22:43165479-43165501 TCCCACTAAATACTTCTTCCTGG - Intergenic
949166255 3:944928-944950 TCCCAATATATCCAATTTCCTGG + Intergenic
952071329 3:29640067-29640089 TGTCACTATATTCTACCTACAGG + Intronic
953991507 3:47487368-47487390 TCACAATATATCCTACCTTTAGG - Intergenic
955353100 3:58208605-58208627 CCCCACAATATCCTGCCTCTTGG + Intronic
955522015 3:59784245-59784267 TGCCACTATTTTCTTCCTCCTGG + Intronic
961864742 3:129945468-129945490 TGCCACTATCTCCCACCTTCAGG - Intergenic
962093476 3:132269569-132269591 TACCACCATATCCTAACACCTGG - Intronic
963228312 3:142885574-142885596 TGCCACTATATCCTAACCGCAGG + Intronic
964405550 3:156344822-156344844 TCCCATTACGTCCTATCTCCAGG + Intronic
965952419 3:174326543-174326565 TTCCACTATAAATTACCTCCTGG - Intergenic
970359375 4:15293086-15293108 TCCCACTATGCCTCACCTCCAGG + Intergenic
970991979 4:22223322-22223344 TCCCAGTGTAACCTAACTCCTGG + Intergenic
975749410 4:77507651-77507673 TCTCACTATTTACTATCTCCAGG + Intergenic
982374985 4:154680041-154680063 TCCTACTGTATCCTGCATCCAGG - Intronic
985106091 4:186501485-186501507 TCCCACTATCCCCTTTCTCCTGG + Intronic
986366761 5:7040671-7040693 TCCCAATATATCCTCATTCCTGG - Intergenic
987663793 5:20909079-20909101 TCCCACCAGACCCCACCTCCAGG + Intergenic
988642201 5:33052481-33052503 TCCAACTATATCTTACCCACAGG + Intergenic
988758891 5:34293116-34293138 TCCCACCAGACCCCACCTCCAGG - Intergenic
993946434 5:94121939-94121961 TCCCACAAAGTCCTACCCCCAGG + Intergenic
994846414 5:104994116-104994138 TCACACAATATCCTGCCTTCAGG + Intergenic
995117851 5:108501396-108501418 TCCCACCAGATCTCACCTCCAGG - Intergenic
997355046 5:133257153-133257175 TCCCACTGTATCCTGGCTCCTGG - Intronic
999846783 5:155490733-155490755 CCCAACTATATGCTACCTACAGG - Intergenic
1001525329 5:172424744-172424766 TCACACAATTTCCTAACTCCTGG + Intronic
1002759793 6:192474-192496 TCCCACAACACCCTTCCTCCCGG + Intergenic
1006530150 6:34645239-34645261 TTCCACTATATCCTGTGTCCTGG - Intronic
1007926331 6:45652329-45652351 ACCCACTTAATCCTTCCTCCTGG - Intronic
1013395862 6:109738924-109738946 TCCCACTATATCCTACCTCCTGG - Intronic
1016524328 6:144984157-144984179 TCCAACTATATGCTGCCTGCAGG - Intergenic
1018730587 6:166646950-166646972 TCCCACTCTGTCCTTTCTCCAGG + Intronic
1018779708 6:167051854-167051876 TCCAACTATATGCTATCTACAGG - Exonic
1020083575 7:5298966-5298988 TCCCACTCCATCCTCCCTCCAGG + Exonic
1025210708 7:57018227-57018249 TCCCACTCCATCCTCCCTCCAGG - Intergenic
1025263332 7:57437489-57437511 TCCCCCTCTATCCCACATCCAGG + Intergenic
1025661248 7:63558620-63558642 TCCCACTCCATCCTCCCTCCAGG + Intergenic
1025740460 7:64192095-64192117 TCCCCCTCTATCCCACATCCAGG + Intronic
1027538120 7:79432682-79432704 TCCCACTGCATTATACCTCCAGG - Intronic
1028071433 7:86455855-86455877 TTCTACTAGATTCTACCTCCTGG + Intergenic
1032856708 7:135840281-135840303 TCCCCCACAATCCTACCTCCTGG - Intergenic
1034105760 7:148488378-148488400 TCCCACTTTATCCTGTGTCCAGG - Intergenic
1037067681 8:14602374-14602396 CCCCAGTAATTCCTACCTCCTGG - Intronic
1037422493 8:18718115-18718137 TCTGACTGTATCTTACCTCCTGG + Intronic
1039870187 8:41539547-41539569 ACCCACCCTATCCCACCTCCAGG + Intronic
1041993187 8:64019670-64019692 TCCAACTATATGCTATCTACAGG + Intergenic
1043033031 8:75162527-75162549 ACCCACTATATGCTGCCTACAGG - Intergenic
1048492986 8:134911923-134911945 TCCCACTGTATCCCATCTCAAGG - Intergenic
1049427266 8:142543051-142543073 TCCCACCATATCCTGGCTCCTGG + Intronic
1051133204 9:13886406-13886428 TCCAACTATACGCTACCTACAGG + Intergenic
1054857598 9:69917269-69917291 TCATACTCTATCCTACCTACTGG - Intergenic
1056904334 9:90632300-90632322 CCACACTATATCCTTGCTCCTGG + Intronic
1059760175 9:117330184-117330206 TCCCATTATACCCTCCCACCAGG + Intronic
1188844226 X:35053653-35053675 TCCCATTAGAACCTGCCTCCAGG - Intergenic
1192771398 X:74195617-74195639 CACCACTATACCCTAGCTCCAGG - Intergenic
1197504493 X:127284644-127284666 TCCAACTATATGCTCTCTCCAGG - Intergenic
1197648632 X:129042223-129042245 TCCCACTGTATCCTGGCTGCAGG - Intergenic
1199929454 X:152503843-152503865 TCACACTATGTGCTACCTCCTGG + Intergenic
1201569356 Y:15397930-15397952 TCCTACTCTGGCCTACCTCCTGG + Intergenic
1202091017 Y:21190216-21190238 TCCCACTATTTCCTGACTGCAGG + Intergenic