ID: 1013399575

View in Genome Browser
Species Human (GRCh38)
Location 6:109779378-109779400
Sequence ATGTGGGAATAAAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013399566_1013399575 28 Left 1013399566 6:109779327-109779349 CCCTTGCTCACCTTGAGTTACAT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG No data
1013399567_1013399575 27 Left 1013399567 6:109779328-109779350 CCTTGCTCACCTTGAGTTACATC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG No data
1013399569_1013399575 18 Left 1013399569 6:109779337-109779359 CCTTGAGTTACATCACAAAGGCA 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG No data
1013399565_1013399575 29 Left 1013399565 6:109779326-109779348 CCCCTTGCTCACCTTGAGTTACA 0: 1
1: 0
2: 0
3: 16
4: 132
Right 1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013399575 Original CRISPR ATGTGGGAATAAAAGGAAGC TGG Intronic
No off target data available for this crispr