ID: 1013400036

View in Genome Browser
Species Human (GRCh38)
Location 6:109784904-109784926
Sequence GTTGGTTTTCTAAAATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013400036 Original CRISPR GTTGGTTTTCTAAAATTTAC TGG (reversed) Intronic
901720145 1:11190734-11190756 TTTGGTTTTCTGAAATTATCAGG + Intronic
902006872 1:13239105-13239127 GTTGGTTTTATACAGTTTAGGGG + Intergenic
902090133 1:13896592-13896614 GTAGGATTTTTAAAAATTACAGG - Intergenic
902847785 1:19125699-19125721 GGTGGTTTTCCATAACTTACAGG - Intronic
904980374 1:34496169-34496191 CTTGGTTTTCTAATGTTTAATGG - Intergenic
904983466 1:34525775-34525797 GTTGGCTTTCTAATACTTACAGG - Intergenic
907149630 1:52271739-52271761 GTGGGATTTCTAAAATTTTCCGG - Intronic
908336924 1:63135571-63135593 CATGGTTTGCTAAACTTTACTGG + Intergenic
909171023 1:72295807-72295829 TTTGGTTTTTTACCATTTACTGG - Intergenic
909845134 1:80384049-80384071 ATTGGTTTTCTACTATTTAATGG + Intergenic
910500989 1:87890173-87890195 GTTGGTTTTCTGATATTTTGAGG - Intergenic
911333430 1:96552149-96552171 CTTGCTTTTCTAAAAATTATCGG + Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912706136 1:111914939-111914961 GTTGGATTTATAAAATATAGAGG + Intronic
913037467 1:114985060-114985082 CCAGGTTTTCTGAAATTTACAGG - Intronic
913059705 1:115193801-115193823 GTTGGTTTTCTCATACTTCCAGG - Intergenic
913083388 1:115411274-115411296 ATTGCTTTACTAAAATTTTCAGG - Intergenic
913134546 1:115875258-115875280 ATGGCTTTTATAAAATTTACTGG + Intergenic
915692895 1:157708055-157708077 GTTGGCTTTCTAGAATTCAGTGG + Intergenic
916178476 1:162063046-162063068 ATATGTTTTCTAAAAATTACAGG - Intergenic
916283192 1:163075291-163075313 GTTGGTTTTGTAAAATTCCATGG + Exonic
917024231 1:170624676-170624698 GTTGATCCTCTAAAATTTACTGG - Intergenic
918979444 1:191536720-191536742 ATTAGTTTTATAAAATTTATAGG - Intergenic
918984884 1:191611587-191611609 TTTGCTTATGTAAAATTTACTGG + Intergenic
919065684 1:192690279-192690301 GTTGGTTTTGTACATTTTAGGGG - Intergenic
919345801 1:196376706-196376728 ATTGGTTTAATAAAATTTATAGG - Intronic
919383820 1:196894277-196894299 ATTGTTTTTCTAAACTTCACTGG + Intronic
921311037 1:213843593-213843615 CATGCTTTTCTAAAATTCACTGG - Intergenic
923525546 1:234769835-234769857 CTTGGATTTATAAAATTAACGGG + Intergenic
923906042 1:238385191-238385213 ATTGTTATTCTAAAATATACCGG - Intergenic
924178710 1:241419461-241419483 ATTGGTTTTTTAAAAATTTCAGG - Intergenic
924660440 1:246011486-246011508 GTCCTTTTTCTAAATTTTACAGG - Intronic
1063180348 10:3592611-3592633 TTTGGTTTGCTAAGATTTCCAGG - Intergenic
1063284817 10:4674981-4675003 ATTGATTTTCTAAATTTTAGCGG - Intergenic
1063318363 10:5029456-5029478 TTTGATTTTTTAAAATTTATTGG + Intronic
1063330475 10:5153935-5153957 TTTATTTTTCTAAAATTTATGGG + Intergenic
1063966542 10:11350532-11350554 CTTGGTTTTCTAATTTTTATTGG + Intergenic
1065731727 10:28715630-28715652 GTTGCTTTTTTAAAATTCAAAGG + Intergenic
1066073890 10:31852344-31852366 GTAAGTTTTCTAAGATGTACAGG - Intronic
1066221421 10:33338084-33338106 ATTGCTTTTCTGAAATTTATGGG - Intergenic
1066666369 10:37786475-37786497 CTTGTTTTTCTAATTTTTACTGG - Intronic
1067131886 10:43572831-43572853 CTTGGTAATTTAAAATTTACTGG + Intronic
1068320248 10:55403811-55403833 GATGATTTTTTTAAATTTACAGG + Intronic
1070119105 10:73558343-73558365 TTTGGTTCTGTAAAATGTACTGG - Intronic
1073794523 10:106973371-106973393 GTTGGGTTTCTAAATTTCACTGG - Intronic
1073895735 10:108155017-108155039 TTGGGTTTTAGAAAATTTACAGG - Intergenic
1075138553 10:119809817-119809839 GTAGAATTTCTAGAATTTACAGG - Intronic
1075899304 10:126026365-126026387 GTTGATTTTCTAATATTGTCAGG - Intronic
1078553505 11:12297978-12298000 TTTCTTTTTCTAAAATTTCCTGG + Intronic
1078803860 11:14676175-14676197 GTTCATTTTCAAAAAATTACTGG + Intronic
1079331487 11:19536547-19536569 GTTTGTTTTCCAAACTTTAATGG - Intronic
1079629846 11:22660563-22660585 GCTTGTTTGCTAAAAGTTACAGG - Intronic
1082553261 11:54527602-54527624 GCTCGTTTTCTAAAATCTGCAGG + Intergenic
1084207458 11:67604317-67604339 ATTGGTTTTATAAAGTTTATAGG + Exonic
1087259647 11:95996301-95996323 GTTGGTTTTCCAGAATTCTCTGG - Intronic
1089095749 11:115918581-115918603 CCTGGTTTTCTAAATTTTATTGG + Intergenic
1089127733 11:116189244-116189266 GTTCCTATTCTAAAATTTCCAGG - Intergenic
1089138619 11:116269221-116269243 TTTTGTTTTCTAAAGTTTTCTGG + Intergenic
1092272453 12:7034036-7034058 GTTACTTTTATAAAATTTATAGG + Intronic
1094355323 12:29571792-29571814 GTTGGTTGTCAAAAATATATTGG - Intronic
1097852875 12:64430821-64430843 GATGGTTTTCTAAATTTAAATGG + Intronic
1098635350 12:72777645-72777667 GATGTTGTTCTAAAATTTCCAGG - Intergenic
1098678311 12:73318706-73318728 CTTGATTTTCTAAAATTGATAGG + Intergenic
1099329585 12:81266551-81266573 TTTAATTTTCTAAAATTTCCTGG + Intronic
1104218823 12:126762235-126762257 GTTCATTTTCTAAAGTTTACAGG - Intergenic
1106106147 13:26735167-26735189 TTTGGTTTTCTAAGATGTAGTGG - Intergenic
1106228622 13:27803966-27803988 GTTGTTTTTCTTAAAGTAACAGG - Intergenic
1106615319 13:31321617-31321639 AGTGGTTTTCAAAAACTTACTGG - Intronic
1107299900 13:38954852-38954874 GTTGGCTTTCTTTAATTTACAGG + Intergenic
1107507939 13:41054114-41054136 GTTGGTTTTTTAAAATATTGTGG - Intronic
1107627119 13:42299971-42299993 GTTGGCTTTCTAACATTAGCTGG - Exonic
1107905211 13:45055225-45055247 ATTGTTTATCTAAAATTCACTGG + Intergenic
1108312742 13:49211914-49211936 CTGGCATTTCTAAAATTTACTGG - Intergenic
1108548336 13:51518830-51518852 CTTGGTTTTCTCAAATTTGTCGG - Intergenic
1108894511 13:55308068-55308090 GTTCGTTGTCTATCATTTACTGG + Intergenic
1109013569 13:56979994-56980016 GTTGGCTTTTGAAAATTCACAGG + Intergenic
1109093621 13:58082009-58082031 CTTTTTTTTCTGAAATTTACTGG - Intergenic
1109949904 13:69487577-69487599 TTTTGTTGTATAAAATTTACTGG + Intergenic
1110231074 13:73168098-73168120 GCAGGTTTTCCAATATTTACTGG - Intergenic
1110400359 13:75082637-75082659 GTTTGTATTCTATATTTTACTGG - Intergenic
1110989578 13:82022494-82022516 GTTGGTGTTCTATAATTAATGGG - Intergenic
1111027381 13:82548492-82548514 ATTTGTTTTCTAAAACTCACAGG - Intergenic
1111687655 13:91521187-91521209 GTTTGCTTTCTAAAATTCTCAGG + Intronic
1112075051 13:95904068-95904090 GTTGGATTTCTAAGACTTAAGGG + Intronic
1113136357 13:107094361-107094383 GCTGGTTTTTCAAAATTTATTGG + Intergenic
1113659906 13:112099245-112099267 GTTGGTTTTCTTAGATTGATAGG + Intergenic
1114987314 14:28246533-28246555 ATTATTTTACTAAAATTTACTGG + Intergenic
1116070774 14:40042270-40042292 GTTAGTTTTTGAAAATTTGCTGG + Intergenic
1116221149 14:42089071-42089093 GATGGTTTTCTTAAAATTCCTGG - Intergenic
1118375285 14:65171443-65171465 GTTGGAACTCTAAAATTCACTGG + Intergenic
1119057409 14:71437209-71437231 GTTGATTTTACAAAATTTGCTGG + Intronic
1120864820 14:89286677-89286699 TTTGGTTTTCTATTATTTCCTGG - Intronic
1126077303 15:44923633-44923655 GTTGGTTTTCAAATATTCATAGG - Intergenic
1126081414 15:44967232-44967254 GTTGGTTTTCAAATATTCATAGG + Intronic
1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG + Intronic
1127008444 15:54596312-54596334 ATTAGTTATCTAAAATTCACAGG - Intronic
1127575254 15:60285675-60285697 GTTGGTTTTATACAATTTAAGGG + Intergenic
1127625696 15:60778243-60778265 GTTTGTTTTTTAATCTTTACGGG + Intronic
1131388137 15:92024822-92024844 GTAGGTTTCCTAATATTTTCTGG - Intronic
1138751502 16:59427945-59427967 GTTTGTTTTCTACAACTTATAGG - Intergenic
1138943500 16:61819219-61819241 GTTGTATTTCTACAATTTATAGG - Intronic
1140573900 16:76140706-76140728 ATTGATTTTTTAAAAATTACTGG + Intergenic
1140828775 16:78732006-78732028 GTTTGTTTTTTTAAATTCACTGG - Intronic
1147781465 17:42945791-42945813 GTTGGTGTTTTAAAATGAACAGG + Intergenic
1153308528 18:3654927-3654949 CTTGGTTTTGTAAAATGTAATGG + Intronic
1153588029 18:6644207-6644229 ATTGGGTTTCAAAAATTCACAGG - Intergenic
1157115842 18:44862212-44862234 GATGGGGTTCTAATATTTACAGG - Intronic
1157984118 18:52418087-52418109 GTTGGTTTTAAATAATTTTCAGG - Intronic
1158525686 18:58210732-58210754 GATGGTTTTATAAAATGAACTGG - Intronic
1159150125 18:64511830-64511852 TTTGGTTTTCTATAAGTTTCTGG + Intergenic
1159337248 18:67084714-67084736 ATTGATTTTTTAAAATTTTCTGG + Intergenic
1160188240 18:76692829-76692851 TTTGGATTTATAAAATTTAAGGG + Intergenic
1164295424 19:23905477-23905499 GTTTGTTTTATATTATTTACTGG + Intergenic
1167984455 19:53302557-53302579 GTTGGTTTTCTGGAACTTGCTGG - Intergenic
1168625926 19:57917857-57917879 GTTGGTTTTATACATTTTAGGGG - Intergenic
1168634524 19:57985459-57985481 GGTACTTTTCTAACATTTACAGG + Intronic
926593358 2:14762908-14762930 CTTGGTTTTCTCATATTTAAGGG - Intergenic
926942020 2:18148438-18148460 GTTGGTTTTCTCCATTTTATTGG + Intronic
927050546 2:19323918-19323940 GTTGGTTGTCTTAAAGTTGCAGG - Intergenic
928536017 2:32242508-32242530 ATTTGTTATCTAAAATTTCCCGG + Intronic
929350975 2:40954475-40954497 GTAGGTGTTCTAAAATTTACTGG + Intergenic
929516783 2:42610571-42610593 GGTGGTTTTCTATGATCTACTGG + Intronic
930882159 2:56283470-56283492 GTTTCTTTTCTAACATTTGCTGG + Intronic
931203958 2:60128853-60128875 GTTGGTTTGCAAAATTTTCCTGG - Intergenic
931368475 2:61640133-61640155 GTTTGTGTTCTAAATTTTCCTGG + Intergenic
931750909 2:65329167-65329189 GGTTGTGTTCTAAAACTTACTGG - Intronic
932009373 2:67959989-67960011 GTTGGTTTTCTCGAATTTTATGG + Intergenic
933627326 2:84616063-84616085 TTTGATTTTCTTAAATTTATTGG + Intronic
933915545 2:86988942-86988964 GTTTGTTTTTTAAAATGTACTGG + Intronic
934007448 2:87780960-87780982 GTTTGTTTTTTAAAATGTACTGG - Intronic
935771090 2:106421874-106421896 GTTTGTTTTTTAAAATGTAGTGG - Intronic
935836060 2:107055142-107055164 TTTGGTTTTCTAAACTTTAAAGG + Intergenic
935908991 2:107874062-107874084 GTTTGTTTTTTAAAATGTACTGG + Intronic
935995671 2:108769516-108769538 GTTTGTTTTTTAAAATGTACTGG + Intronic
936130772 2:109839190-109839212 GTTTGTTTTTTAAAATGTAGTGG + Intronic
936213925 2:110532295-110532317 GTTTGTTTTTTAAAATGTAGTGG - Intronic
936423062 2:112386855-112386877 GTTTGTTTTTTAAAATGTAGTGG - Intronic
939626972 2:144489666-144489688 GTTTCCTTTCAAAAATTTACAGG + Intronic
940024753 2:149194206-149194228 GTTGGTTTCCTATAACTTAATGG + Intronic
940061167 2:149570669-149570691 GTTAATTTCCAAAAATTTACTGG + Intronic
941233599 2:162941775-162941797 TCTAATTTTCTAAAATTTACAGG - Intergenic
941840959 2:170083790-170083812 AGTGCTTTTTTAAAATTTACTGG - Exonic
942036990 2:172019676-172019698 GTAGGTTTTATAAAGTTTATAGG - Intronic
942602616 2:177657119-177657141 GTTGGTTTTATGTAATTTATAGG - Intronic
942994151 2:182240816-182240838 GTTATTTTCCTAAAATTTAGAGG - Intronic
944458920 2:199923942-199923964 ATTTGTTCTATAAAATTTACTGG - Intronic
944648602 2:201805627-201805649 GATGGTTTTTTAAAATGTTCAGG - Intronic
944861224 2:203817579-203817601 GAAGGTTTTCTCAAACTTACAGG - Intergenic
946345012 2:219102376-219102398 TTTGGTTTTCTATATTTTAGTGG + Intronic
947114495 2:226754251-226754273 AATGGTTTACTAAAATATACTGG - Intronic
1168910735 20:1444674-1444696 CTTGGTTTGCTAAAAGTCACAGG - Intronic
1169810768 20:9606970-9606992 GTTAATTTTCTAAAATTGATTGG - Intronic
1170308582 20:14967849-14967871 GTAGGTTATATAAAATTTATTGG - Intronic
1175110285 20:56643156-56643178 TTTGCTTTTCTGAAATCTACAGG + Intergenic
1175556879 20:59869415-59869437 CTTGATTTTCTATATTTTACAGG + Intronic
1177221857 21:18204913-18204935 GTTTTCTTTCTAAAAATTACAGG - Intronic
1180832729 22:18914155-18914177 GTTGCTTTTCTAAAAGCAACTGG + Intronic
1180891989 22:19295809-19295831 TTTGGTTCTTTATAATTTACAGG - Intergenic
1184198569 22:42948683-42948705 TTTGGTTTTCAAATATTTTCTGG + Intronic
1184623972 22:45707892-45707914 GTGGGTTTTCTCCAATTTCCAGG - Intronic
1184751822 22:46490709-46490731 GTTGGTTTTGTAGATTTTTCTGG - Intronic
1203282814 22_KI270734v1_random:139460-139482 GTTGCTTTTCTAAAAGCAACTGG + Intergenic
950764617 3:15264242-15264264 GTCAGTTTTCTACAACTTACAGG - Intronic
951186844 3:19723276-19723298 GTTGGCTTTTGAAAATTCACAGG + Intergenic
951395194 3:22156598-22156620 GTTTGTATTCTAACATGTACTGG - Intronic
951972332 3:28460906-28460928 GTTGGTTTTTAAACATTTAGTGG + Intronic
956029486 3:65022159-65022181 GTTAATTTTCAAAAATTTCCAGG - Intergenic
958834396 3:99127423-99127445 TTTGTTTCTCTAAAATTTTCAGG + Intergenic
959021225 3:101189430-101189452 GTGGTTTTCCTAAAAGTTACAGG - Intergenic
959588971 3:108054408-108054430 TTTGGTTTTATAATATTTAGAGG - Intronic
961948247 3:130716843-130716865 TTTTGTTTTCTAAAATTTCCTGG - Intronic
962729920 3:138272231-138272253 GTGGGTTTTCTTAACTTTACTGG - Intronic
963460860 3:145613256-145613278 GTTGCTTTTTTAAAAGTTGCAGG + Intergenic
965327101 3:167320151-167320173 ATTGTTTTTCTAAAAAATACTGG - Intronic
965422063 3:168473006-168473028 ATCAGTTTTCTACAATTTACAGG + Intergenic
966064626 3:175803920-175803942 GTTGATTTTCTAAGAATTTCAGG + Exonic
967472672 3:189880535-189880557 GTTGTTTTTCTAAAATTCACAGG + Intronic
967755486 3:193163725-193163747 GTTGGCTTTAAAAGATTTACAGG - Intergenic
970095426 4:12458693-12458715 GTTGGTTTTCTCAGCTGTACTGG + Intergenic
970584501 4:17502094-17502116 GTTTATTTTGTAAAATTTATTGG - Intronic
970826341 4:20280632-20280654 TCTGTTTTTCAAAAATTTACAGG + Intronic
971050187 4:22853186-22853208 TTCGATTTTCTTAAATTTACTGG + Intergenic
971269493 4:25127799-25127821 TGTGGTTTTCTAATAGTTACTGG - Intronic
972124961 4:35752892-35752914 GGTGGTTTTTTAAAATGTAAGGG - Intergenic
972917628 4:43901005-43901027 GTTGGCTTTCTAAGAATCACAGG - Intergenic
973941020 4:55910571-55910593 GTTAATTTTATAAAGTTTACAGG + Intergenic
977919589 4:102628141-102628163 GTTGGTTTTGTAAAATTTATTGG - Intergenic
978087672 4:104673983-104674005 TTTGGTTTTCTAAAATGTATTGG + Intergenic
980027011 4:127780001-127780023 GTTTATTTTCAAAATTTTACTGG + Intergenic
980810335 4:137869381-137869403 GTTGATTTTATTAAATTTTCTGG - Intergenic
981870774 4:149483329-149483351 CTTGGTTTTCTAATTTTTAAAGG + Intergenic
982651407 4:158092129-158092151 GTGAGTTTACTAAAATTAACTGG + Intergenic
982941585 4:161564829-161564851 GTTTTTATTCTAAAATTCACTGG + Intronic
983326598 4:166265812-166265834 CATGATTTTATAAAATTTACTGG + Intergenic
983542642 4:168929590-168929612 GTTGTATTTCTATAATTTAAAGG - Intronic
984186885 4:176555126-176555148 GTTGATTTTCTCAAATTTTCAGG + Intergenic
984591443 4:181621991-181622013 CTTGGTTTTTTAGATTTTACCGG - Intergenic
985420909 4:189784259-189784281 GTTGGTTTTTTAACACTTATGGG + Intergenic
985432799 4:189897679-189897701 TTTGTTTATATAAAATTTACGGG - Intergenic
986964614 5:13255363-13255385 ATGGGTTTTCTAATATTTATTGG + Intergenic
986988288 5:13523611-13523633 GTTGGTGTTCTAAATTTTCCTGG + Intergenic
987101368 5:14594126-14594148 GTTGTTTTTCTACCAGTTACGGG - Intronic
987136512 5:14904568-14904590 GTTGGTTTTAAAATATATACTGG - Intergenic
987462985 5:18236334-18236356 CTTGGTTATCTAAAATTAACAGG + Intergenic
987997480 5:25304342-25304364 GTTGGTTTTCTCACATTTTGTGG + Intergenic
989372783 5:40726869-40726891 TTTAGTTTTCTAACATTAACAGG - Intronic
990176876 5:53117791-53117813 ATTAGGTTTCTAAATTTTACCGG - Intergenic
991211518 5:64110506-64110528 ATTCATATTCTAAAATTTACTGG - Intergenic
992930300 5:81636440-81636462 TTTCATTTTCTAAAATTTTCTGG - Intronic
993091386 5:83430716-83430738 TTTGGCTTTCTAAAAATTATAGG + Intergenic
993239799 5:85367838-85367860 GTTGGGCTTTTAAAATATACTGG - Intergenic
993539301 5:89128717-89128739 GTTTGTTCTGTTAAATTTACTGG - Intergenic
993796879 5:92278258-92278280 TTTGATTTTCTTAAATTTATTGG - Intergenic
994130044 5:96216753-96216775 GTTGCTTTTCTGGAAGTTACAGG + Intergenic
994292788 5:98049868-98049890 GCTTGTTTTCTAAAAGCTACCGG + Intergenic
994702612 5:103155725-103155747 AATGTTTTTCTAAAAATTACAGG - Intronic
995030871 5:107479904-107479926 TTTAGTTTTTTAAAATATACTGG - Intronic
996114925 5:119607584-119607606 GTGGCTTTGCTAAGATTTACAGG + Intronic
996298007 5:121946735-121946757 GATGGTTCTCTAAAACTTACAGG - Intergenic
996438507 5:123462303-123462325 GTTGATTTTTTAAACTTTAAAGG - Intergenic
996658763 5:125973731-125973753 GTTTGATGTCTAAAATTTAAAGG - Intergenic
996807637 5:127475434-127475456 TTAGGTTTTTTAAAATTTCCTGG + Intergenic
999081255 5:148845866-148845888 GTTGAGTTTCTAACATTTCCTGG + Intergenic
1000518669 5:162272723-162272745 ATTAGTTTTCTATAATTTATAGG + Intergenic
1001999036 5:176186206-176186228 GATGATTTTCTAAAATATAAAGG + Intergenic
1004173958 6:13322665-13322687 GTTTTTTTTCTAACATTAACTGG - Intronic
1005445956 6:25923319-25923341 ATTGGTTATATAGAATTTACAGG + Intronic
1005464357 6:26097600-26097622 GTTTGTTTTCTCAAATTTTCAGG - Exonic
1008214512 6:48771468-48771490 TATGTTTTTCTAAAATTTAGGGG - Intergenic
1008612109 6:53194000-53194022 GTTGGTTTTCTCTAATTCATAGG + Intergenic
1009056299 6:58340222-58340244 CTTGTTTTTCTAGAATTTCCTGG - Intergenic
1009234884 6:61110379-61110401 CTTGTTTTTCTAGAATTTCCTGG + Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1010866181 6:80979121-80979143 GTTGGTTTTCTAATTTGTATTGG - Intergenic
1012243899 6:96904688-96904710 GCTGTTTTTCTAAAATCTATTGG - Intergenic
1013400036 6:109784904-109784926 GTTGGTTTTCTAAAATTTACTGG - Intronic
1013749405 6:113385936-113385958 GTTGGTTTTATAAAATTATAAGG + Intergenic
1014149696 6:118040373-118040395 GTTGCTTTTCTAGAATTTGTAGG + Intronic
1014862121 6:126482145-126482167 GCTGGGTTTCTTAATTTTACTGG + Intergenic
1014877687 6:126681413-126681435 TTTGGTGTTCAAAAAATTACAGG - Intergenic
1014944507 6:127480881-127480903 GTGGGTTTTTTAAAAGTGACAGG + Intronic
1015036789 6:128665698-128665720 TTTGGTCTTGTAAAATTTAGTGG + Intergenic
1015613685 6:135052880-135052902 GTTTGTGTTCTAAAACCTACTGG - Intronic
1017353792 6:153477761-153477783 TTTGCTTTTCAAAAATTTAGAGG + Intergenic
1017470344 6:154732995-154733017 GTTGCTTTTCACAACTTTACTGG - Intergenic
1020642017 7:10767415-10767437 ATTGCTATTATAAAATTTACGGG + Intergenic
1020847874 7:13310559-13310581 TTTGGCTTTCGAAAATTTGCAGG + Intergenic
1021425050 7:20489977-20489999 TTTGGTTTTTAAAAATTTGCTGG - Intergenic
1021745050 7:23731828-23731850 GCTTGTTTTCTAATATATACAGG + Intronic
1023313734 7:38913924-38913946 GATGTTTTTCATAAATTTACTGG + Intronic
1024320696 7:48065719-48065741 GCAGGTTTTCAAAAATTTCCTGG - Intergenic
1024896788 7:54269638-54269660 GGTGGTGTTCTAAAAGTTTCTGG + Intergenic
1024910219 7:54438861-54438883 GTTTGTTTTTTACAATTTTCTGG - Intergenic
1025222735 7:57129529-57129551 GTTGGCTTTTTTAAGTTTACAGG + Intronic
1025633527 7:63301202-63301224 GTTGGCTTTTTTAAGTTTACAGG + Intergenic
1025649169 7:63446955-63446977 GTTGGCTTTTTTAAGTTTACAGG - Intergenic
1025720140 7:64002810-64002832 GTTGGCTTTTTTAAGTTTACAGG - Intergenic
1027960685 7:84941568-84941590 TTTGGCTTTCGAAAATTCACAGG + Intergenic
1029811236 7:103051221-103051243 GTTGGCTTTTGAAAATTCACAGG - Intronic
1029858824 7:103547242-103547264 GTTAGGCTTCTAAAATTTAGTGG + Intronic
1030724054 7:112903866-112903888 GTTGTTTTTAAAAAATCTACTGG + Intronic
1031317030 7:120271530-120271552 GTTGGTTTTCTTATATTAATTGG + Intergenic
1031856748 7:126932020-126932042 GATGCTATTTTAAAATTTACAGG - Intronic
1033975194 7:147092244-147092266 AATGTTTTTCTAAAATTAACTGG + Intronic
1035562885 8:619694-619716 GTTGGGTTTGTAACATATACAGG + Intronic
1036642793 8:10594496-10594518 GTGGGCTTTGTAAAATGTACAGG + Intergenic
1036761748 8:11514298-11514320 GTGGGTTTTCTCACATTTGCTGG - Intronic
1038968663 8:32605935-32605957 GTTGGGTTGCTAAAATATAGGGG + Intronic
1039160316 8:34611726-34611748 TGTGGTTTTCTAAAAAATACTGG - Intergenic
1039739040 8:40363048-40363070 TTTGGTTTTGTAATATTTATAGG - Intergenic
1040937943 8:52800490-52800512 ATTAATTTTATAAAATTTACAGG - Intergenic
1041564006 8:59255224-59255246 TATGTTTTTCTAAAATATACAGG + Intergenic
1041631051 8:60087382-60087404 GTTGGTTTGCTGATATTTTCAGG - Intergenic
1042112934 8:65400438-65400460 ATTTCTTTTTTAAAATTTACTGG - Intergenic
1042608211 8:70568072-70568094 TTTGATTTTCTTAAATTTACTGG - Intergenic
1043545340 8:81308898-81308920 TTTTATTTTCTTAAATTTACTGG - Intergenic
1044651800 8:94503851-94503873 TTTGGTTTTTTTAAATTAACAGG - Intronic
1045405577 8:101863548-101863570 GTTGGTATTCTTAAAATAACAGG + Intronic
1045984902 8:108238702-108238724 GTTGCTTTTCTAAAAATATCTGG + Intronic
1046429432 8:114105102-114105124 TTGTGATTTCTAAAATTTACAGG - Intergenic
1046587838 8:116169307-116169329 GTTGGTTTTTTAAACTGTAGAGG - Intergenic
1046592288 8:116220993-116221015 GTTGGTTTTGTGATATGTACAGG - Intergenic
1046751041 8:117926807-117926829 GATGGATTTCTAAATTTTCCTGG + Intronic
1047890225 8:129300595-129300617 TTCAGTTTTCTTAAATTTACTGG + Intergenic
1048511537 8:135066739-135066761 GTTGGTTGAGTAAAATTTTCTGG + Intergenic
1050623705 9:7481436-7481458 TTAGGTCTTCTAACATTTACTGG - Intergenic
1051393747 9:16595586-16595608 GGTGGTTTTCTCAAATTCAAAGG + Intronic
1051540454 9:18210667-18210689 GTCAGTTTTCTATAACTTACAGG + Intergenic
1053558732 9:39166648-39166670 ATCAGTTTTCTACAATTTACAGG - Intronic
1054138379 9:61452293-61452315 ATCAGTTTTCTACAATTTACAGG + Intergenic
1185803961 X:3040063-3040085 CTTGGCTTTATACAATTTACGGG - Intergenic
1186218057 X:7321523-7321545 TTTGTTTTTCTAACCTTTACAGG - Intronic
1187388221 X:18867806-18867828 GTTGGCTTTGTAAAATAAACTGG + Intergenic
1187981317 X:24760576-24760598 TTTTGTTTTCTAAATTTGACAGG - Intronic
1189315306 X:40051420-40051442 GTTAGTTTTCAATATTTTACAGG + Exonic
1189829541 X:44956821-44956843 GTTGGCTTTTTAAAAATTACGGG + Intronic
1189833275 X:44996831-44996853 GTTCGTTTTCTACCATTTATAGG + Intronic
1190623287 X:52310552-52310574 GTTGTATTACTAAAATTTAGGGG + Intergenic
1191038691 X:56056166-56056188 GTTGGTTTTCTCATCTTTATGGG + Intergenic
1192613738 X:72595042-72595064 TTTGGTTTTCTAGTATTTCCTGG - Intronic
1192700542 X:73466375-73466397 TTTAGTTTACTTAAATTTACTGG + Intergenic
1193562353 X:83033605-83033627 GTTGCTTCTCTAAATTTTATTGG - Intergenic
1193919049 X:87403932-87403954 GTTCTTATTCTAAAATATACAGG + Intergenic
1194304608 X:92227798-92227820 TTTAGTTTTCTAAATTTTAATGG - Intronic
1196148038 X:112341522-112341544 GTTGGTTTTATTAAATTGACTGG + Intergenic
1198559649 X:137835597-137835619 TTTGATTTTCTTAAATTTACTGG + Intergenic
1199205329 X:145142218-145142240 AATGATTATCTAAAATTTACAGG - Intergenic
1201733771 Y:17235126-17235148 TTTGGATTACTAAAAGTTACTGG + Intergenic