ID: 1013400807

View in Genome Browser
Species Human (GRCh38)
Location 6:109794534-109794556
Sequence CCACAGATACTGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 204}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013400807_1013400814 -6 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400814 6:109794551-109794573 CTGTGGGGTAACTGTGCCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1013400807_1013400819 14 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400819 6:109794571-109794593 AGGGTGACCAAGGGATGTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 125
1013400807_1013400820 15 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400820 6:109794572-109794594 GGGTGACCAAGGGATGTTCAGGG No data
1013400807_1013400822 24 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400822 6:109794581-109794603 AGGGATGTTCAGGGACTGATTGG 0: 1
1: 0
2: 1
3: 13
4: 169
1013400807_1013400817 5 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400817 6:109794562-109794584 CTGTGCCAGAGGGTGACCAAGGG No data
1013400807_1013400816 4 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400816 6:109794561-109794583 ACTGTGCCAGAGGGTGACCAAGG 0: 1
1: 0
2: 1
3: 20
4: 175
1013400807_1013400815 -5 Left 1013400807 6:109794534-109794556 CCTCCCTCCATCAGTATCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1013400815 6:109794552-109794574 TGTGGGGTAACTGTGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013400807 Original CRISPR CCACAGATACTGATGGAGGG AGG (reversed) Intronic
901226341 1:7614886-7614908 CATCAGATACTGCTGGGGGGAGG + Intronic
902669205 1:17960899-17960921 CCACAGATACTGATCAAGCCTGG - Intergenic
902677408 1:18018363-18018385 CCACAGTAACTGATTGAGGAAGG - Intergenic
905086804 1:35387129-35387151 GCAGAGCTACTGATGGAGGTGGG - Exonic
905872187 1:41411296-41411318 CCACACTGACTGCTGGAGGGAGG - Intergenic
907265269 1:53255571-53255593 CAACAGATACTGATGGAAAAAGG - Intronic
907486912 1:54784376-54784398 CACCAGATGGTGATGGAGGGAGG + Intronic
907564926 1:55425748-55425770 CCAGAGACAGGGATGGAGGGAGG - Intergenic
907585702 1:55615962-55615984 CCACAGAGACTGCTGTAGTGGGG + Intergenic
908107504 1:60860375-60860397 CCAGAGTTAGTGATGGAAGGAGG - Intergenic
908169587 1:61491499-61491521 CTAGAGATACTGATGGGAGGTGG - Intergenic
908912762 1:69091606-69091628 ACACAGAGACAGAGGGAGGGAGG - Intergenic
910453864 1:87374556-87374578 CAACAGACACTGGTGGAGGGTGG - Intergenic
915399434 1:155611613-155611635 CTCCAGATACTGATGGATGGGGG + Intronic
915416547 1:155747193-155747215 CTCCAGATACTGATGGATGGGGG + Intergenic
916215669 1:162390913-162390935 CCACAGAGAAGGATTGAGGGTGG + Intergenic
917640988 1:176982968-176982990 CCACAGATGATGATTGAGGGGGG + Intronic
919761643 1:201101928-201101950 CAACATATGCTGATGGAGGAGGG - Intronic
919846749 1:201647687-201647709 CCTCAGAGACTGAAGTAGGGCGG + Intronic
920965260 1:210696019-210696041 CCAGAGAAACTGCTGGAGAGTGG - Intronic
922158612 1:223060663-223060685 GTACAGATTGTGATGGAGGGAGG - Intergenic
922301785 1:224308087-224308109 CCAAAGATTCTGAAGGAGGATGG - Exonic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
1064326114 10:14353144-14353166 CCACAGATACTCATGCGGGTAGG + Intronic
1067535721 10:47108478-47108500 CCACAGATCCTGCTGGATGCCGG - Intergenic
1069224330 10:65923039-65923061 CCCCACATATTGAGGGAGGGAGG - Intronic
1071285803 10:84143741-84143763 CCTCAAATATTGTTGGAGGGAGG + Intronic
1071500521 10:86200428-86200450 CCACAGATGCTGAGAGAGGTAGG + Intronic
1073475198 10:103748021-103748043 CCACAGAAAATGCTGGTGGGAGG - Intronic
1074779346 10:116789995-116790017 GCAAAGCTACTGATGGAGCGTGG - Intergenic
1075347728 10:121696574-121696596 CCCAAGATAATGATGCAGGGGGG - Intergenic
1075492586 10:122885290-122885312 CCACAGTAGCTGATGGAGTGTGG + Intergenic
1075498290 10:122947565-122947587 CCACAGTAGCTGACGGAGGGTGG - Intronic
1076824211 10:132959164-132959186 CCACAAGGACTGAGGGAGGGAGG - Intergenic
1078578981 11:12524485-12524507 GGACAGATACTGATAGAGGCAGG - Intronic
1078755402 11:14204191-14204213 CCACAGGGACTGAGGGAGGAAGG + Intronic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1080922876 11:36726367-36726389 GCACAGAGACAGAGGGAGGGAGG + Intergenic
1082719732 11:56659162-56659184 CAACACACCCTGATGGAGGGTGG - Intergenic
1083581007 11:63825382-63825404 CCACAGACACAGAGGGAGTGAGG - Intronic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1085927719 11:81041148-81041170 TCCCAGATTCTGATGCAGGGAGG - Intergenic
1087801158 11:102506119-102506141 CAACACACCCTGATGGAGGGTGG - Intergenic
1090177756 11:124666327-124666349 CCACAGAGAATATTGGAGGGTGG - Intronic
1090659213 11:128870082-128870104 CCACAGAGAGTTATGGAGGCTGG - Intergenic
1090966070 11:131598555-131598577 CCCCAGTGACTAATGGAGGGGGG - Intronic
1093395304 12:18673759-18673781 CAACAGCTACTGAAAGAGGGTGG - Intergenic
1095126917 12:38490335-38490357 CCTCAGATACTGATGGGGAGGGG + Intergenic
1097589477 12:61556619-61556641 CAACAGACACTAATTGAGGGTGG - Intergenic
1097734021 12:63162355-63162377 CCAAAGAAACTGAAGGAGGAGGG + Intergenic
1098141690 12:67456641-67456663 CTTCAGAAACTGCTGGAGGGTGG - Intergenic
1100408909 12:94295334-94295356 CCCCATATAGTGATGGAAGGTGG - Intronic
1100748575 12:97672417-97672439 CCACAGATACTTCTGGAGAAAGG + Intergenic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1102889563 12:116547806-116547828 TCACAGATTCTGAGGAAGGGTGG + Intergenic
1102998948 12:117370386-117370408 CAACAGATATGGATGGATGGAGG - Intronic
1103315019 12:120046226-120046248 GCACAGGGACTGATGGAGGATGG - Intronic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1113446627 13:110373770-110373792 CCACAGATGCTGGAGGACGGAGG - Intronic
1114398716 14:22389814-22389836 GCACAGATGCTGAGCGAGGGGGG - Intergenic
1118073233 14:62269216-62269238 CCATAGATAAGGATAGAGGGTGG - Intergenic
1119364923 14:74083890-74083912 CCACGGATAGTGAAGTAGGGTGG + Intronic
1119640453 14:76310585-76310607 CCACAGCCACTGATGGACGCAGG - Intergenic
1121234167 14:92380099-92380121 CCACAGACACTGAAGGCAGGAGG + Intronic
1121835417 14:97087947-97087969 ACACAGATATTGATGTGGGGTGG + Intergenic
1122731397 14:103801418-103801440 CCATTGATGCTGATGGAGGGAGG - Intronic
1125088447 15:35760324-35760346 ACACAGGTAGTGATGGAGAGTGG - Intergenic
1125551648 15:40549585-40549607 CCACATAGAATGATGGAGGGGGG - Intronic
1128940267 15:71782235-71782257 CAGCAGATAATGATGGAGGGGGG + Exonic
1128963803 15:72037169-72037191 GCACACATAGTGATGGTGGGTGG - Intronic
1129273306 15:74430697-74430719 CCACAGAGTCTCATGGTGGGGGG - Intronic
1132173793 15:99691188-99691210 CAACAGAGACAGAGGGAGGGGGG + Intronic
1140234910 16:73150132-73150154 CCGCAGATGCTGCTGGATGGAGG + Intergenic
1141640039 16:85335627-85335649 CCACAGCCACTGCTGCAGGGTGG + Intergenic
1142199782 16:88755637-88755659 CCCCAGATACTGAAGGAGCCGGG - Intronic
1142414883 16:89935925-89935947 CCATAAATACTGCAGGAGGGCGG - Exonic
1143336935 17:6178479-6178501 CCTCAGTCACTGATAGAGGGCGG + Intergenic
1143355811 17:6327638-6327660 CCACGGATACAGATGCAGAGTGG - Intergenic
1144439567 17:15269305-15269327 CCACAGATGCAAGTGGAGGGGGG + Intergenic
1144672309 17:17139764-17139786 CCAGAGATACTGCTGGTGAGAGG + Intronic
1146503952 17:33388458-33388480 CCACAGAGAATGAAGGTGGGTGG + Intronic
1147133621 17:38422860-38422882 CCATATTTAATGATGGAGGGTGG - Intergenic
1147150466 17:38510950-38510972 TCACAGACACTGATGCAGGCGGG - Exonic
1148684848 17:49495582-49495604 TCCCAGATACTGAGGGTGGGTGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1153774603 18:8441565-8441587 CCCCAGATACAGATACAGGGAGG + Intergenic
1155679870 18:28475781-28475803 CCACTGACACTGATGGAGGATGG - Intergenic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1158393215 18:57060304-57060326 ACACACAGACTGATGGAGGTAGG + Intergenic
1159060641 18:63510617-63510639 CCAAAGTTACTGAGGGAGGTAGG + Intergenic
1162013042 19:7829730-7829752 CCAATGCTACTGAAGGAGGGCGG - Intergenic
1163365172 19:16871949-16871971 CCACTTATCCTGAGGGAGGGTGG + Intronic
1164230642 19:23284717-23284739 ACACAGAGATTGATGGAGAGAGG - Intergenic
1164309985 19:24037111-24037133 CTACAGATACTGATTCAGGCAGG - Intronic
1164935795 19:32210203-32210225 CCACTGATACTGTTGGGGGATGG - Intergenic
1165227679 19:34365951-34365973 TCACTGATACTGGTGGAGGCGGG + Intronic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1167677667 19:50897568-50897590 CCAGAGATTCTGTGGGAGGGTGG - Intergenic
1168112711 19:54203065-54203087 CCATAGATACTGATGCTGGGTGG + Intronic
925817805 2:7770166-7770188 CCCCACATATTGAGGGAGGGAGG - Intergenic
926019919 2:9485742-9485764 ACACAGATACTGGTGAAGAGGGG + Intronic
926176427 2:10596243-10596265 CCACAGATGGTGGTGGGGGGCGG + Intronic
926846963 2:17152037-17152059 CCACAGACAGTGATGGAGGAGGG + Intergenic
928649931 2:33393198-33393220 CAACAGACACTAGTGGAGGGTGG - Intronic
929784231 2:44977613-44977635 CAACATATCCTGGTGGAGGGAGG - Intergenic
930116753 2:47724786-47724808 CCACAGTGATTCATGGAGGGAGG - Intronic
930942385 2:57028297-57028319 ACATAGATCATGATGGAGGGAGG - Intergenic
931747335 2:65301583-65301605 CCATAGTTACTGATGGAGCATGG + Intergenic
934131837 2:88956001-88956023 CCACAAAAATTGATGGAGTGGGG + Intergenic
935299169 2:101678825-101678847 ACACTGATTCTGATGGGGGGCGG - Intergenic
937158662 2:119740015-119740037 CCACAGGCACTGGTGCAGGGAGG + Intergenic
938164564 2:129015430-129015452 CCAGGGACACTGATGGAGAGGGG + Intergenic
938926624 2:136048998-136049020 CCACACCTAGTGATGGAGTGAGG - Intergenic
939364057 2:141209808-141209830 ACACAGACACGGATGGAGGGAGG + Intronic
940672210 2:156684488-156684510 CCACAGATATTGGGGGCGGGGGG + Intergenic
941448202 2:165627737-165627759 CCATAGTTACTAATGGTGGGAGG - Intronic
942495830 2:176539049-176539071 CCTCTGATTCTGAAGGAGGGTGG - Intergenic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
1168924593 20:1568685-1568707 CCACAGAAAGTGATGAAGGGAGG + Intronic
1169820985 20:9709814-9709836 CAACAGCTACTGTTGGAGGGTGG - Intronic
1170691907 20:18623977-18623999 TGACAGGAACTGATGGAGGGTGG + Intronic
1173371708 20:42442187-42442209 ACACAGACATTGATGGAGAGAGG - Intronic
1175852229 20:62099706-62099728 CCACAGACACTCATTGAGTGTGG - Intergenic
1177993837 21:28071604-28071626 CCACAGATCAGGGTGGAGGGTGG + Intergenic
1179107305 21:38413893-38413915 CCAAAGATACATATGGAGAGAGG - Intronic
1179979758 21:44889782-44889804 ACACAGAAACTGAGGCAGGGCGG + Intronic
1180215197 21:46319066-46319088 CCATAGATACTGATGGACATGGG - Intronic
1180655615 22:17418431-17418453 CCACAGGTACTGGGAGAGGGAGG + Intronic
1181866570 22:25861929-25861951 CCACAGATACATATGGAGGGTGG - Intronic
1182256355 22:29041626-29041648 CCACAGAGACTGATTGAGCAGGG - Intronic
1182586921 22:31348830-31348852 ACACAGATAGTGATGGAGCCAGG + Intergenic
1185023247 22:48392908-48392930 CCAGAGACACTGATGGGTGGAGG + Intergenic
953102751 3:39845761-39845783 GCACAGATACTGATCCAGGCAGG + Intronic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
954576415 3:51678777-51678799 CCACACACACTGAGGGAGGAGGG - Intronic
955663589 3:61327233-61327255 CCTCAGAACCTGATGGAGGGTGG + Intergenic
956114849 3:65907927-65907949 CCACAGAGAGTGATGGAGCCGGG - Intronic
957334567 3:78810435-78810457 TCTTAGAAACTGATGGAGGGTGG + Intronic
957685693 3:83501770-83501792 CCACAGCTGCTGCTGGAAGGTGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
959241932 3:103808083-103808105 CCACAGATACTCAAGGTGGCAGG + Intergenic
960389032 3:117054281-117054303 GCATAGATACTGAGGGTGGGGGG + Intronic
960493753 3:118350692-118350714 CTACAGAGAATGATGAAGGGAGG - Intergenic
961496685 3:127298022-127298044 CCAGAGATTCTGATGAAGTGTGG + Intergenic
961554522 3:127688902-127688924 CCACACACGCTGATGGAGGCTGG + Intergenic
961629217 3:128284023-128284045 TCACAGGAACTGCTGGAGGGAGG - Intronic
961698751 3:128725726-128725748 ACACAGAAACTGGTGGAGCGAGG - Intergenic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
962974499 3:140434201-140434223 CCAGAGATCCTGGTGGAGGGAGG + Intronic
964256396 3:154779180-154779202 ACACAAAGAGTGATGGAGGGTGG - Intergenic
965614233 3:170576827-170576849 TCACAGATACTGGAGGAGAGGGG - Intronic
965948861 3:174279106-174279128 CCCCAGATATTGATGGAGCAAGG + Exonic
968384844 4:126483-126505 CCACAGTTTCTGTAGGAGGGTGG + Intronic
969935612 4:10677524-10677546 CCCCAGGTGCTGAGGGAGGGAGG + Intronic
970124528 4:12793900-12793922 TCACACAATCTGATGGAGGGTGG - Intergenic
970253623 4:14143499-14143521 CCATAGATAATGATAGAGGAGGG + Intergenic
970566249 4:17335004-17335026 TCACAGATACTGAATGGGGGTGG - Intergenic
971336645 4:25729376-25729398 CTACAAATACTCATGAAGGGTGG - Intergenic
972103574 4:35453037-35453059 CCACACATGTTGAGGGAGGGAGG - Intergenic
972816760 4:42654492-42654514 ACACAGATCCTGAGAGAGGGTGG - Intronic
972963287 4:44479827-44479849 TCACACATTCTGTTGGAGGGAGG - Intergenic
974155755 4:58070043-58070065 CCACAGAGACAGAAGGAGGGAGG + Intergenic
976851967 4:89558161-89558183 CCACAGAAACTGGTAGATGGGGG + Intergenic
978897230 4:113903571-113903593 CCTCAGAAACTGAAGGAGGTTGG - Exonic
982330324 4:154175208-154175230 CCAGAGGTAAGGATGGAGGGAGG - Intergenic
984293666 4:177827190-177827212 CCACAGATACTTGGAGAGGGGGG - Intronic
986518977 5:8593815-8593837 CCACAAAGACTGATAGAGGGGGG - Intergenic
986940048 5:12938047-12938069 CCACAGCTGCTGCTGGAAGGAGG - Intergenic
987370209 5:17186360-17186382 CCACAGATAGTGGAGGAGGAAGG - Intronic
987418559 5:17691397-17691419 CCACAGAGAAAGATGGAGGCAGG + Intergenic
990607595 5:57426191-57426213 TAGCAGATGCTGATGGAGGGAGG + Intergenic
992270607 5:75059158-75059180 CCACAAAAACTGTAGGAGGGAGG + Intergenic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
997418206 5:133745418-133745440 CCACAGAAGCTGCTGGTGGGGGG + Intergenic
1001118818 5:168962099-168962121 CCAGAGATGCTGGTGGAGGCAGG - Intronic
1001516710 5:172360454-172360476 CCTCACACACTGCTGGAGGGAGG + Intronic
1003184360 6:3817966-3817988 CCACAGAGACTCAGGGAGTGGGG - Intergenic
1003497036 6:6673262-6673284 CCACAGATGCTGAGTGAGGTCGG - Intergenic
1004913597 6:20310567-20310589 CAACAGACACTAATAGAGGGGGG + Intergenic
1007182175 6:39937268-39937290 CCACAGTTACTGATAGAATGGGG - Intergenic
1007421329 6:41721567-41721589 GCACAGATACTTTTGGAGGGAGG - Intronic
1010719687 6:79268928-79268950 TCAGAAATTCTGATGGAGGGGGG + Intergenic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1014105696 6:117558284-117558306 CTACAGAAATGGATGGAGGGGGG - Intronic
1018616432 6:165691108-165691130 CCACAGGCACTGATGGGGGGGGG - Intronic
1018918889 6:168157053-168157075 GCACTGATGCTGTTGGAGGGTGG - Intergenic
1020083219 7:5297410-5297432 CCACAGATGCGGGTGGAGTGGGG - Intronic
1021921333 7:25488445-25488467 AGACAGATAGAGATGGAGGGAGG - Intergenic
1022429970 7:30308499-30308521 CCAGAGATTCTGATTGAGGGTGG - Intronic
1022535848 7:31097801-31097823 CAACAGATACAGTTGGGGGGGGG + Intronic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1025211058 7:57019793-57019815 CCACAGATGCGGGTGGAGTGGGG + Intergenic
1025660897 7:63557054-63557076 CCACAGATGCGGGTGGAGTGGGG - Intergenic
1026365396 7:69643576-69643598 CCCCAGATACTGATGAGGGCAGG + Intronic
1027173260 7:75887805-75887827 CCACAGATGCCCAGGGAGGGTGG - Intronic
1033719105 7:144038001-144038023 TCACAGCCACTGAGGGAGGGAGG + Intergenic
1037865605 8:22440582-22440604 CCACAAAAACTGAAGGAGCGCGG + Intergenic
1037933283 8:22897320-22897342 GCACAGATATGGATGGAGGAGGG + Intronic
1039248416 8:35634620-35634642 TTACAAATACTGATGCAGGGGGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040721334 8:50328645-50328667 CCCCACATGCTGAGGGAGGGAGG - Intronic
1041301319 8:56414839-56414861 CAGCAGATATTGAGGGAGGGAGG - Intergenic
1041445648 8:57948562-57948584 GCAGAGATCCTGGTGGAGGGGGG - Intergenic
1042338616 8:67655579-67655601 CCACAGATACTGATTAATGCAGG - Intronic
1045708352 8:104954537-104954559 CTACAGAAATGGATGGAGGGAGG + Intronic
1046710336 8:117504376-117504398 CCAAAGATACTGATGTTAGGTGG - Intergenic
1049562444 8:143318481-143318503 CCAAAGGGACTGGTGGAGGGAGG - Intronic
1052699700 9:31922640-31922662 GAACAGCTACTGATGGAGGCTGG + Intergenic
1057009616 9:91589827-91589849 TCACAGACACTGATGGGTGGAGG - Intronic
1057549716 9:96043416-96043438 CTACAAATATTGAAGGAGGGTGG + Intergenic
1058124550 9:101176508-101176530 CCACAGATACTGCAAGAAGGTGG - Intronic
1058175320 9:101729200-101729222 CCACACAGACTTATGCAGGGAGG - Intronic
1059245434 9:112845697-112845719 CCACAGATACTGATATTGGCTGG + Intronic
1060102234 9:120850769-120850791 ACAGAGATACTGGGGGAGGGGGG + Intergenic
1061739548 9:132690865-132690887 CCACTGATTCTAATGGGGGGAGG - Exonic
1062192699 9:135255997-135256019 GCAAAGAGACGGATGGAGGGTGG - Intergenic
1062260439 9:135660088-135660110 CCACAGACCCTGAAGGAGGCTGG - Intergenic
1186078255 X:5903599-5903621 CCCCAGATCCTGATGGAGCAAGG - Exonic
1186432287 X:9515102-9515124 CCAGGCAGACTGATGGAGGGGGG + Intronic
1188288198 X:28355307-28355329 TCACAGATACTGATGAAAGAGGG - Intergenic
1188818910 X:34749093-34749115 CCACAGATAGTGGGGGTGGGAGG + Intergenic
1189651452 X:43194256-43194278 ACCCAGGTACTGCTGGAGGGAGG - Intergenic
1189849928 X:45168088-45168110 TCCCAGGTACTGAAGGAGGGAGG + Intronic
1190434071 X:50406331-50406353 CCACACATACTCATCCAGGGTGG - Intronic
1190481785 X:50884551-50884573 CCACAGATGTTGTTGAAGGGTGG - Intergenic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1195910041 X:109880137-109880159 ACACAGCTATTGATGGAGGTTGG + Intergenic
1196673822 X:118398434-118398456 CAACAGATACTGATGGTGGAAGG + Exonic
1198747474 X:139904847-139904869 CCAGAGATACTGTTGCAGGCAGG + Intronic
1198754031 X:139964411-139964433 CAACAGATGCTGATGAGGGGAGG + Intronic
1201517088 Y:14829975-14829997 CCCCAGATCCTGATGGAGCAAGG + Exonic