ID: 1013406668

View in Genome Browser
Species Human (GRCh38)
Location 6:109849774-109849796
Sequence AGTTATCTGTAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013406668_1013406675 25 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406675 6:109849822-109849844 GGCCAGTTACTGGGCTTTGGTGG No data
1013406668_1013406670 4 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG No data
1013406668_1013406674 22 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406674 6:109849819-109849841 CTTGGCCAGTTACTGGGCTTTGG 0: 2
1: 176
2: 172
3: 115
4: 236
1013406668_1013406673 16 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406673 6:109849813-109849835 ACAGTTCTTGGCCAGTTACTGGG No data
1013406668_1013406672 15 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013406668 Original CRISPR AGTTATCTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr