ID: 1013406670

View in Genome Browser
Species Human (GRCh38)
Location 6:109849801-109849823
Sequence TCCTTTTGAGAGACAGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013406666_1013406670 27 Left 1013406666 6:109849751-109849773 CCTCTAGGATTTTGGAGCAAGGC 0: 143
1: 187
2: 148
3: 132
4: 240
Right 1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG No data
1013406667_1013406670 5 Left 1013406667 6:109849773-109849795 CCCTGCCATCTTCTACAGATAAC No data
Right 1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG No data
1013406669_1013406670 0 Left 1013406669 6:109849778-109849800 CCATCTTCTACAGATAACTACTC No data
Right 1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG No data
1013406668_1013406670 4 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013406670 Original CRISPR TCCTTTTGAGAGACAGTTCT TGG Intergenic
No off target data available for this crispr