ID: 1013406672

View in Genome Browser
Species Human (GRCh38)
Location 6:109849812-109849834
Sequence GACAGTTCTTGGCCAGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013406669_1013406672 11 Left 1013406669 6:109849778-109849800 CCATCTTCTACAGATAACTACTC No data
Right 1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG No data
1013406667_1013406672 16 Left 1013406667 6:109849773-109849795 CCCTGCCATCTTCTACAGATAAC No data
Right 1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG No data
1013406668_1013406672 15 Left 1013406668 6:109849774-109849796 CCTGCCATCTTCTACAGATAACT No data
Right 1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013406672 Original CRISPR GACAGTTCTTGGCCAGTTAC TGG Intergenic
No off target data available for this crispr