ID: 1013406761

View in Genome Browser
Species Human (GRCh38)
Location 6:109850508-109850530
Sequence CCTCTGCTGAGATGACCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013406761_1013406764 3 Left 1013406761 6:109850508-109850530 CCAACGGGTCATCTCAGCAGAGG No data
Right 1013406764 6:109850534-109850556 ATTTTAATAATCAAGTAGATAGG 0: 13
1: 182
2: 223
3: 183
4: 497
1013406761_1013406765 19 Left 1013406761 6:109850508-109850530 CCAACGGGTCATCTCAGCAGAGG No data
Right 1013406765 6:109850550-109850572 AGATAGGATGACCCATTCTGTGG 0: 7
1: 74
2: 155
3: 203
4: 283
1013406761_1013406767 30 Left 1013406761 6:109850508-109850530 CCAACGGGTCATCTCAGCAGAGG No data
Right 1013406767 6:109850561-109850583 CCCATTCTGTGGACACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013406761 Original CRISPR CCTCTGCTGAGATGACCCGT TGG (reversed) Intergenic
No off target data available for this crispr