ID: 1013409857

View in Genome Browser
Species Human (GRCh38)
Location 6:109874340-109874362
Sequence TAGGAACCCTTGCCAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013409853_1013409857 30 Left 1013409853 6:109874287-109874309 CCTAAGGCAGCAGGATTTTAAAA No data
Right 1013409857 6:109874340-109874362 TAGGAACCCTTGCCAGAGAGTGG No data
1013409854_1013409857 6 Left 1013409854 6:109874311-109874333 CCAGAGTGATGCTAGTGTGCAGC No data
Right 1013409857 6:109874340-109874362 TAGGAACCCTTGCCAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013409857 Original CRISPR TAGGAACCCTTGCCAGAGAG TGG Intergenic