ID: 1013410504

View in Genome Browser
Species Human (GRCh38)
Location 6:109879599-109879621
Sequence TGGTGATCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013410504_1013410512 19 Left 1013410504 6:109879599-109879621 CCGTCCACCACTGCTGATCACCA No data
Right 1013410512 6:109879641-109879663 GACTTCCACCCCTCTGGATCTGG 0: 28
1: 72
2: 82
3: 94
4: 145
1013410504_1013410513 23 Left 1013410504 6:109879599-109879621 CCGTCCACCACTGCTGATCACCA No data
Right 1013410513 6:109879645-109879667 TCCACCCCTCTGGATCTGGCAGG 0: 10
1: 48
2: 85
3: 148
4: 393
1013410504_1013410510 13 Left 1013410504 6:109879599-109879621 CCGTCCACCACTGCTGATCACCA No data
Right 1013410510 6:109879635-109879657 GCCACTGACTTCCACCCCTCTGG 0: 20
1: 67
2: 87
3: 104
4: 238
1013410504_1013410515 24 Left 1013410504 6:109879599-109879621 CCGTCCACCACTGCTGATCACCA No data
Right 1013410515 6:109879646-109879668 CCACCCCTCTGGATCTGGCAGGG 0: 10
1: 46
2: 99
3: 132
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013410504 Original CRISPR TGGTGATCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr