ID: 1013414335

View in Genome Browser
Species Human (GRCh38)
Location 6:109911561-109911583
Sequence ATTTCAAAAAGACGTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013414335_1013414340 26 Left 1013414335 6:109911561-109911583 CCTGGGAAACGTCTTTTTGAAAT No data
Right 1013414340 6:109911610-109911632 TGTCTCTCAATTACTGTGGAAGG No data
1013414335_1013414337 22 Left 1013414335 6:109911561-109911583 CCTGGGAAACGTCTTTTTGAAAT No data
Right 1013414337 6:109911606-109911628 CCCCTGTCTCTCAATTACTGTGG No data
1013414335_1013414341 27 Left 1013414335 6:109911561-109911583 CCTGGGAAACGTCTTTTTGAAAT No data
Right 1013414341 6:109911611-109911633 GTCTCTCAATTACTGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013414335 Original CRISPR ATTTCAAAAAGACGTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr